Incidental Mutation 'R7629:Ppara'
ID 589568
Institutional Source Beutler Lab
Gene Symbol Ppara
Ensembl Gene ENSMUSG00000022383
Gene Name peroxisome proliferator activated receptor alpha
Synonyms Ppar, Nr1c1, PPAR-alpha, PPARalpha, 4933429D07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 85734983-85802819 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85798191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 363 (M363L)
Ref Sequence ENSEMBL: ENSMUSP00000059719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057979] [ENSMUST00000109422] [ENSMUST00000109423]
AlphaFold P23204
Predicted Effect probably damaging
Transcript: ENSMUST00000057979
AA Change: M363L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059719
Gene: ENSMUSG00000022383
AA Change: M363L

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109422
AA Change: M363L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105049
Gene: ENSMUSG00000022383
AA Change: M363L

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109423
AA Change: M363L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105050
Gene: ENSMUSG00000022383
AA Change: M363L

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit loss of diurnal variation in hepatic fatty acid and cholesterol synthesis, increased hepatic lipid and gonadal adipose stores, impaired skin wound healing, and altered metabolic responses to starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Ppara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ppara APN 15 85801067 missense probably benign 0.00
IGL00754:Ppara APN 15 85777642 missense probably damaging 0.99
IGL01409:Ppara APN 15 85777643 missense probably damaging 0.98
IGL02080:Ppara APN 15 85789019 missense possibly damaging 0.74
IGL02442:Ppara APN 15 85801143 missense probably benign 0.19
IGL02810:Ppara APN 15 85777677 missense probably damaging 0.99
IGL02852:Ppara APN 15 85797878 missense probably benign 0.00
R0333:Ppara UTSW 15 85790960 missense probably damaging 1.00
R0551:Ppara UTSW 15 85787105 splice site probably benign
R0883:Ppara UTSW 15 85798171 missense probably damaging 1.00
R1125:Ppara UTSW 15 85789055 missense possibly damaging 0.71
R1189:Ppara UTSW 15 85798164 missense probably benign 0.04
R1233:Ppara UTSW 15 85798021 missense probably damaging 1.00
R1582:Ppara UTSW 15 85798228 missense possibly damaging 0.69
R1755:Ppara UTSW 15 85797979 missense probably benign 0.14
R1913:Ppara UTSW 15 85801099 missense probably damaging 1.00
R2163:Ppara UTSW 15 85801046 missense probably benign 0.04
R4570:Ppara UTSW 15 85787197 missense probably benign 0.02
R4980:Ppara UTSW 15 85787233 missense probably damaging 0.99
R5117:Ppara UTSW 15 85777761 missense probably benign 0.00
R5749:Ppara UTSW 15 85789028 missense probably benign 0.35
R6199:Ppara UTSW 15 85787233 missense probably damaging 0.99
R6221:Ppara UTSW 15 85777680 missense probably benign 0.02
R6624:Ppara UTSW 15 85791036 missense probably benign 0.24
R7382:Ppara UTSW 15 85787228 missense probably damaging 1.00
R7534:Ppara UTSW 15 85777726 missense probably benign
R8171:Ppara UTSW 15 85797876 missense probably benign
R8848:Ppara UTSW 15 85788987 missense possibly damaging 0.93
R9378:Ppara UTSW 15 85777636 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATTTGCCAAGGCTATCCCAG -3'
(R):5'- GAGCTCACGTCACTATATCGGC -3'

Sequencing Primer
(F):5'- CAGGCTTTGCAAACTTGGAC -3'
(R):5'- TATCGGCATACATATTGGCACC -3'
Posted On 2019-10-24