Incidental Mutation 'R7629:Flywch1'
ID589570
Institutional Source Beutler Lab
Gene Symbol Flywch1
Ensembl Gene ENSMUSG00000040097
Gene NameFLYWCH-type zinc finger 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7629 (G1)
Quality Score179.009
Status Not validated
Chromosome17
Chromosomal Location23752793-23771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23755770 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 632 (M632T)
Ref Sequence ENSEMBL: ENSMUSP00000040022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045517] [ENSMUST00000086325]
Predicted Effect probably benign
Transcript: ENSMUST00000045517
AA Change: M632T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040022
Gene: ENSMUSG00000040097
AA Change: M632T

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 83 1.2e-24 PFAM
Pfam:FLYWCH 92 150 7e-17 PFAM
Pfam:FLYWCH 235 293 3.3e-17 PFAM
low complexity region 352 380 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
Pfam:FLYWCH 402 460 9.7e-18 PFAM
Pfam:FLYWCH 490 548 7.9e-18 PFAM
Pfam:FLYWCH 581 639 6.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086325
AA Change: M632T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083505
Gene: ENSMUSG00000040097
AA Change: M632T

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 84 9.7e-10 PFAM
Pfam:FLYWCH 92 150 3.8e-17 PFAM
Pfam:FLYWCH 235 293 3.1e-17 PFAM
Pfam:FLYWCH_u 294 401 1.3e-30 PFAM
Pfam:FLYWCH 402 460 9.1e-18 PFAM
Pfam:FLYWCH 490 548 6.8e-18 PFAM
Pfam:FLYWCH_u 549 568 9.1e-3 PFAM
Pfam:FLYWCH 581 639 4.7e-17 PFAM
Pfam:FLYWCH_u 640 672 4.6e-4 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Flywch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Flywch1 APN 17 23763026 missense probably benign 0.01
IGL01843:Flywch1 APN 17 23760345 missense possibly damaging 0.89
IGL02110:Flywch1 APN 17 23763092 splice site probably null
IGL02586:Flywch1 APN 17 23755702 missense probably benign 0.04
IGL02870:Flywch1 APN 17 23755902 missense probably damaging 1.00
IGL02877:Flywch1 APN 17 23760414 missense probably damaging 1.00
lubdub UTSW 17 23761059 missense possibly damaging 0.93
R0830:Flywch1 UTSW 17 23762370 missense probably benign 0.00
R1411:Flywch1 UTSW 17 23755824 missense probably damaging 1.00
R2044:Flywch1 UTSW 17 23762313 nonsense probably null
R2153:Flywch1 UTSW 17 23755650 missense probably benign 0.21
R2314:Flywch1 UTSW 17 23763026 missense probably benign 0.01
R2497:Flywch1 UTSW 17 23755711 missense probably benign 0.27
R3022:Flywch1 UTSW 17 23763108 missense probably benign 0.00
R3625:Flywch1 UTSW 17 23760201 splice site probably benign
R3691:Flywch1 UTSW 17 23763212 missense probably damaging 0.96
R4805:Flywch1 UTSW 17 23760617 missense probably benign 0.16
R5321:Flywch1 UTSW 17 23756651 missense probably damaging 1.00
R7148:Flywch1 UTSW 17 23755675 missense probably benign 0.01
R7200:Flywch1 UTSW 17 23761059 missense possibly damaging 0.93
R8362:Flywch1 UTSW 17 23756708 missense probably damaging 1.00
RF003:Flywch1 UTSW 17 23762166 frame shift probably null
RF007:Flywch1 UTSW 17 23762164 frame shift probably null
RF007:Flywch1 UTSW 17 23762171 frame shift probably null
RF009:Flywch1 UTSW 17 23762161 frame shift probably null
RF010:Flywch1 UTSW 17 23762175 frame shift probably null
RF013:Flywch1 UTSW 17 23762175 frame shift probably null
RF018:Flywch1 UTSW 17 23762166 frame shift probably null
RF022:Flywch1 UTSW 17 23762167 frame shift probably null
RF027:Flywch1 UTSW 17 23762158 frame shift probably null
RF031:Flywch1 UTSW 17 23762158 frame shift probably null
RF038:Flywch1 UTSW 17 23762164 frame shift probably null
RF040:Flywch1 UTSW 17 23762169 frame shift probably null
RF041:Flywch1 UTSW 17 23762161 frame shift probably null
RF041:Flywch1 UTSW 17 23762177 frame shift probably null
RF046:Flywch1 UTSW 17 23762169 frame shift probably null
RF046:Flywch1 UTSW 17 23762174 frame shift probably null
RF049:Flywch1 UTSW 17 23762171 frame shift probably null
RF058:Flywch1 UTSW 17 23762177 frame shift probably null
X0009:Flywch1 UTSW 17 23755655 small deletion probably benign
X0028:Flywch1 UTSW 17 23761095 missense probably damaging 1.00
Z1176:Flywch1 UTSW 17 23761009 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGCAAAGGTTCTGAAAATGCAC -3'
(R):5'- TCCTGGGATTACAGTGAGCAG -3'

Sequencing Primer
(F):5'- CAAGTTAGGCAAAAGCCCTGGTC -3'
(R):5'- TGGTGCCCTCACAGTGACTC -3'
Posted On2019-10-24