Mutagenetix > Incidental Mutations

Incidental Mutation 'R7629:Fhod3'

589571

Institutional Source

Beutler Lab

Gene Symbol

Fhod3

Ensembl Gene

ENSMUSG00000034295

Gene Name

formin homology 2 domain containing 3

Synonyms

A930009H06Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7629 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24709445-25133500 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24754317 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 88 (D88E)

Ref Sequence

ENSEMBL: ENSMUSP00000041361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037097]

AlphaFold

Q76LL6

Predicted Effect

probably benign
Transcript: ENSMUST00000037097
AA Change: D88E

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: D88E

Domain	Start	End	E-Value	Type
PDB:3DAD\|B	1	327	1e-127	PDB
Blast:Drf_GBD	73	204	3e-60	BLAST
Blast:FH2	219	306	4e-25	BLAST
low complexity region	399	420	N/A	INTRINSIC
low complexity region	428	446	N/A	INTRINSIC
low complexity region	553	583	N/A	INTRINSIC
coiled coil region	598	632	N/A	INTRINSIC
low complexity region	674	701	N/A	INTRINSIC
low complexity region	753	763	N/A	INTRINSIC
low complexity region	784	793	N/A	INTRINSIC
Blast:FH2	879	918	1e-9	BLAST
Blast:FH2	931	964	1e-7	BLAST
low complexity region	965	980	N/A	INTRINSIC
low complexity region	985	1023	N/A	INTRINSIC
FH2	1039	1492	3.96e-72	SMART
Blast:FH2	1506	1570	9e-11	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	G	A	16: 88,707,405	T168I	probably benign	Het
2410089E03Rik	C	T	15: 8,227,067	Q2004*	probably null	Het
Abtb2	T	A	2: 103,683,493		probably null	Het
Ankrd10	A	T	8: 11,615,769	V277E	probably benign	Het
Ankrd28	C	T	14: 31,715,264	V615I	probably benign	Het
Aqr	G	A	2: 114,114,593	P1079L	probably damaging	Het
Brox	G	A	1: 183,292,504	A60V	probably damaging	Het
Copg1	T	C	6: 87,894,169	V289A	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
D430042O09Rik	T	C	7: 125,795,250	L192P	probably damaging	Het
Dido1	T	C	2: 180,661,473	N1546S	probably benign	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmxl1	T	A	18: 49,859,270	I361N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Flywch1	A	G	17: 23,755,770	M632T	probably benign	Het
Henmt1	A	G	3: 108,958,597	T213A	probably benign	Het
Itga9	T	C	9: 118,698,446	V555A	probably benign	Het
Kif13b	C	T	14: 64,779,335	R1317*	probably null	Het
Kndc1	A	T	7: 139,895,260	E25V	probably damaging	Het
Lingo2	T	A	4: 35,708,675	D435V	possibly damaging	Het
Lrrc14b	T	A	13: 74,361,164	M375L	probably benign	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mgat4c	G	A	10: 102,389,070	V382I	probably benign	Het
Mpp6	T	C	6: 50,196,623	I489T	probably benign	Het
Muc16	T	C	9: 18,566,785	T7075A	possibly damaging	Het
Myo5b	T	A	18: 74,627,254		probably null	Het
Neb	T	C	2: 52,273,961	D1995G	possibly damaging	Het
Nudt9	T	C	5: 104,050,694	V75A	possibly damaging	Het
Olfr1277	C	T	2: 111,269,876	V164I	probably benign	Het
Paf1	T	C	7: 28,395,068	Y35H	probably damaging	Het
Panx3	T	A	9: 37,661,444	Q270L	possibly damaging	Het
Pde6h	G	T	6: 136,959,319	R20L	possibly damaging	Het
Pdxk	A	G	10: 78,445,006	I200T	probably benign	Het
Ppara	A	T	15: 85,798,191	M363L	probably damaging	Het
Prmt8	A	T	6: 127,689,883	L376*	probably null	Het
Serpina1a	G	C	12: 103,853,808	T393R	probably damaging	Het
Sfxn1	C	T	13: 54,093,022	R178C	probably damaging	Het
Sirpb1c	A	T	3: 15,848,395	W7R	possibly damaging	Het
Skint5	T	C	4: 113,942,660	Y104C	probably damaging	Het
Slamf6	A	T	1: 171,936,624	T195S	probably damaging	Het
Slc2a6	T	C	2: 27,024,202	D301G	probably benign	Het
Stab2	A	T	10: 86,883,782		probably null	Het
Tctn3	C	G	19: 40,611,336	D141H	probably damaging	Het
Tnik	A	G	3: 28,661,728	N1164D	probably damaging	Het
Tpcn1	C	T	5: 120,537,937	V711I	probably benign	Het
Trim11	G	A	11: 58,978,334	G32D	probably damaging	Het
Usp32	TTTGGTTG	TTTG	11: 85,019,855		probably null	Het
Vmn1r72	T	C	7: 11,669,784	I246V	probably benign	Het
Zfp362	G	T	4: 128,786,055	R273S	probably damaging	Het
Zfp715	T	C	7: 43,301,676	D66G	possibly damaging	Het

Other mutations in Fhod3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Fhod3	APN	18	24994540	missense	probably damaging	1.00
IGL01139:Fhod3	APN	18	25066344	missense	probably benign	0.00
IGL01293:Fhod3	APN	18	25020652	splice site	probably benign
IGL01313:Fhod3	APN	18	25020720	missense	probably damaging	1.00
IGL01524:Fhod3	APN	18	25130602	missense	probably damaging	0.99
IGL01568:Fhod3	APN	18	25120162	missense	probably benign	0.04
IGL01586:Fhod3	APN	18	25090747	missense	probably damaging	0.98
IGL01622:Fhod3	APN	18	25022867	missense	probably benign	0.35
IGL01623:Fhod3	APN	18	25022867	missense	probably benign	0.35
IGL01640:Fhod3	APN	18	25115793	missense	probably benign	0.13
IGL01860:Fhod3	APN	18	24897681	missense	probably damaging	0.99
IGL01860:Fhod3	APN	18	24903948	missense	probably damaging	1.00
IGL02192:Fhod3	APN	18	25056358	missense	probably damaging	1.00
IGL02390:Fhod3	APN	18	25066275	missense	probably benign	0.15
IGL02550:Fhod3	APN	18	25022960	missense	probably benign	0.00
IGL02987:Fhod3	APN	18	25113553	missense	possibly damaging	0.87
R0328:Fhod3	UTSW	18	25113600	missense	probably benign	0.01
R0362:Fhod3	UTSW	18	25090076	nonsense	probably null
R0373:Fhod3	UTSW	18	25090104	missense	possibly damaging	0.93
R0483:Fhod3	UTSW	18	24709616	missense	probably damaging	1.00
R0570:Fhod3	UTSW	18	25112583	missense	probably benign	0.27
R0617:Fhod3	UTSW	18	25112679	splice site	probably benign
R0834:Fhod3	UTSW	18	25115805	nonsense	probably null
R0836:Fhod3	UTSW	18	25066218	missense	probably damaging	1.00
R1132:Fhod3	UTSW	18	25020665	small deletion	probably benign
R1157:Fhod3	UTSW	18	24985236	missense	probably damaging	1.00
R1158:Fhod3	UTSW	18	24985236	missense	probably damaging	1.00
R1160:Fhod3	UTSW	18	24985236	missense	probably damaging	1.00
R1381:Fhod3	UTSW	18	25090471	missense	probably damaging	1.00
R1533:Fhod3	UTSW	18	25115864	missense	probably damaging	1.00
R1621:Fhod3	UTSW	18	25022867	missense	probably benign	0.35
R1748:Fhod3	UTSW	18	24770493	nonsense	probably null
R1757:Fhod3	UTSW	18	25066278	missense	possibly damaging	0.78
R1758:Fhod3	UTSW	18	25120310	missense	possibly damaging	0.88
R1872:Fhod3	UTSW	18	25130610	missense	probably damaging	1.00
R1911:Fhod3	UTSW	18	25112586	missense	possibly damaging	0.81
R1917:Fhod3	UTSW	18	24989965	splice site	probably benign
R1917:Fhod3	UTSW	18	25085601	missense	probably benign	0.27
R1934:Fhod3	UTSW	18	25090278	missense	probably benign	0.35
R1958:Fhod3	UTSW	18	25090465	missense	probably damaging	1.00
R1997:Fhod3	UTSW	18	25090416	missense	possibly damaging	0.79
R3618:Fhod3	UTSW	18	25020665	small deletion	probably benign
R3709:Fhod3	UTSW	18	25090758	missense	probably damaging	1.00
R3937:Fhod3	UTSW	18	25090761	missense	probably benign	0.44
R4246:Fhod3	UTSW	18	24990066	missense	probably null	1.00
R4248:Fhod3	UTSW	18	24990066	missense	probably null	1.00
R4249:Fhod3	UTSW	18	24990066	missense	probably null	1.00
R4497:Fhod3	UTSW	18	25110239	critical splice donor site	probably null
R4498:Fhod3	UTSW	18	25110239	critical splice donor site	probably null
R4532:Fhod3	UTSW	18	25110221	missense	probably damaging	1.00
R4596:Fhod3	UTSW	18	25115718	missense	probably benign	0.01
R4628:Fhod3	UTSW	18	25120129	missense	possibly damaging	0.94
R4667:Fhod3	UTSW	18	25066338	missense	probably benign	0.00
R4668:Fhod3	UTSW	18	25066338	missense	probably benign	0.00
R4734:Fhod3	UTSW	18	25028135	missense	probably benign	0.00
R4753:Fhod3	UTSW	18	25090325	missense	possibly damaging	0.80
R4796:Fhod3	UTSW	18	24985301	missense	probably damaging	1.00
R4832:Fhod3	UTSW	18	25090248	missense	probably benign	0.00
R5338:Fhod3	UTSW	18	25028081	missense	probably damaging	0.96
R5832:Fhod3	UTSW	18	25090695	missense	probably damaging	1.00
R5863:Fhod3	UTSW	18	25125753	missense	probably benign	0.25
R6362:Fhod3	UTSW	18	24754255	missense	probably benign	0.00
R6414:Fhod3	UTSW	18	25090878	missense	possibly damaging	0.64
R7099:Fhod3	UTSW	18	25090162	missense	probably benign
R7172:Fhod3	UTSW	18	25085546	missense	probably damaging	1.00
R7190:Fhod3	UTSW	18	25090755	missense	probably damaging	1.00
R7241:Fhod3	UTSW	18	25060352	missense	probably damaging	1.00
R7294:Fhod3	UTSW	18	25132980	missense	probably damaging	1.00
R7348:Fhod3	UTSW	18	25090467	missense	possibly damaging	0.80
R7432:Fhod3	UTSW	18	25001909	missense	possibly damaging	0.95
R7588:Fhod3	UTSW	18	25090248	missense	probably benign	0.02
R7667:Fhod3	UTSW	18	25001944	missense	probably benign
R7681:Fhod3	UTSW	18	24990038	missense	probably damaging	1.00
R7829:Fhod3	UTSW	18	25115890	critical splice donor site	probably null
R7889:Fhod3	UTSW	18	24770494	missense	probably damaging	0.99
R8072:Fhod3	UTSW	18	25020665	small deletion	probably benign
R8117:Fhod3	UTSW	18	25115853	missense	probably damaging	1.00
R8245:Fhod3	UTSW	18	25113616	missense	probably damaging	1.00
R8511:Fhod3	UTSW	18	25132937	missense	probably damaging	0.99
R8518:Fhod3	UTSW	18	25056333	missense	probably damaging	1.00
R8845:Fhod3	UTSW	18	25132919	missense	probably damaging	0.99
R8889:Fhod3	UTSW	18	25056395	critical splice donor site	probably null
R8892:Fhod3	UTSW	18	25056395	critical splice donor site	probably null
R9016:Fhod3	UTSW	18	25110079	missense	possibly damaging	0.90
R9035:Fhod3	UTSW	18	25028083	missense	probably benign	0.03
R9063:Fhod3	UTSW	18	25020715	missense	probably damaging	0.99
R9157:Fhod3	UTSW	18	25085594	missense	probably damaging	0.98
R9201:Fhod3	UTSW	18	24994556	nonsense	probably null
R9244:Fhod3	UTSW	18	25115865	missense	probably damaging	1.00
R9268:Fhod3	UTSW	18	24709775	critical splice donor site	probably null
R9415:Fhod3	UTSW	18	24969187	missense	probably damaging	1.00
Z1177:Fhod3	UTSW	18	25020706	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAACTTAAGTGACCTGATGG -3'
(R):5'- TCTCTTAAGCCAGGCTACCCAC -3'

Sequencing Primer
(F):5'- ATGGTACCTGGTCTCTATCAGAAGAG -3'
(R):5'- ACAAGGAGCAAAGTCTCTCAAG -3'

Posted On

2019-10-24