Incidental Mutation 'R7629:Lrrtm2'
ID 589572
Institutional Source Beutler Lab
Gene Symbol Lrrtm2
Ensembl Gene ENSMUSG00000071862
Gene Name leucine rich repeat transmembrane neuronal 2
Synonyms C630011A14Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 35209011-35215024 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 35214257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042345] [ENSMUST00000091636]
AlphaFold Q8BGA3
Predicted Effect probably benign
Transcript: ENSMUST00000042345
SMART Domains Protein: ENSMUSP00000049007
Gene: ENSMUSG00000037815

DomainStartEndE-ValueType
Pfam:Vinculin 19 339 2.6e-99 PFAM
Pfam:Vinculin 333 867 3.3e-218 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000091636
SMART Domains Protein: ENSMUSP00000089225
Gene: ENSMUSG00000071862

DomainStartEndE-ValueType
LRRNT 33 61 2.45e0 SMART
LRR_TYP 84 107 5.14e-3 SMART
LRR_TYP 108 131 3.58e-2 SMART
LRR_TYP 132 155 1.6e-4 SMART
LRR_TYP 156 179 4.24e-4 SMART
LRR 180 203 1.14e0 SMART
LRR 204 224 6.05e0 SMART
LRR 228 251 5.12e1 SMART
LRR 252 275 1.97e2 SMART
LRR 276 299 2.45e0 SMART
Blast:LRRCT 311 360 2e-11 BLAST
transmembrane domain 422 444 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Lrrtm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Lrrtm2 APN 18 35213268 missense probably benign 0.13
IGL00835:Lrrtm2 APN 18 35214239 missense probably benign 0.03
IGL01097:Lrrtm2 APN 18 35212941 missense probably damaging 1.00
IGL01589:Lrrtm2 APN 18 35212798 missense probably damaging 1.00
IGL02106:Lrrtm2 APN 18 35212815 nonsense probably null
R0149:Lrrtm2 UTSW 18 35212932 missense probably benign 0.28
R0361:Lrrtm2 UTSW 18 35212932 missense probably benign 0.28
R0924:Lrrtm2 UTSW 18 35213755 missense probably damaging 1.00
R1189:Lrrtm2 UTSW 18 35213492 nonsense probably null
R1417:Lrrtm2 UTSW 18 35213958 missense probably damaging 1.00
R1585:Lrrtm2 UTSW 18 35213375 missense possibly damaging 0.86
R3433:Lrrtm2 UTSW 18 35213897 missense probably damaging 1.00
R4019:Lrrtm2 UTSW 18 35212870 missense possibly damaging 0.76
R4540:Lrrtm2 UTSW 18 35213146 missense probably benign 0.29
R4664:Lrrtm2 UTSW 18 35214257 splice site probably null
R4879:Lrrtm2 UTSW 18 35213319 missense probably damaging 0.98
R5797:Lrrtm2 UTSW 18 35213706 missense probably damaging 1.00
R7378:Lrrtm2 UTSW 18 35213592 missense probably damaging 1.00
R7387:Lrrtm2 UTSW 18 35212972 missense probably damaging 1.00
R7391:Lrrtm2 UTSW 18 35212765 missense possibly damaging 0.75
R7408:Lrrtm2 UTSW 18 35213635 missense possibly damaging 0.88
R7584:Lrrtm2 UTSW 18 35212765 missense possibly damaging 0.75
R8105:Lrrtm2 UTSW 18 35213457 missense probably damaging 0.99
R8163:Lrrtm2 UTSW 18 35213724 missense probably damaging 1.00
R8490:Lrrtm2 UTSW 18 35213398 splice site probably null
R8702:Lrrtm2 UTSW 18 35212965 missense probably damaging 1.00
Z1176:Lrrtm2 UTSW 18 35214659 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTTTGGCACTGAGTGGAAGC -3'
(R):5'- GATGCAAATCACTTGGTTCGGG -3'

Sequencing Primer
(F):5'- CCCTGAGAGTCGCAGTAGAATAGC -3'
(R):5'- CAAATCACTTGGTTCGGGATTTTAAG -3'
Posted On 2019-10-24