Mutagenetix > Incidental Mutation

Incidental Mutation 'R7629:Myo5b'

589574

Institutional Source

Beutler Lab

Gene Symbol

Myo5b

Ensembl Gene

ENSMUSG00000025885

Gene Name

myosin VB

Synonyms

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.707) question?

Stock #

R7629 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74440936-74771493 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 74627254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000073790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000074157] [ENSMUST00000121875] [ENSMUST00000121875]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000074157

SMART Domains

Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885

Domain	Start	End	E-Value	Type
MYSc	63	763	N/A	SMART
IQ	764	786	2.41e-4	SMART
IQ	787	809	7.7e-3	SMART
IQ	812	834	2.18e-2	SMART
IQ	835	857	1.72e0	SMART
IQ	860	882	7.52e-6	SMART
IQ	883	905	4.12e-3	SMART
low complexity region	1053	1065	N/A	INTRINSIC
coiled coil region	1140	1261	N/A	INTRINSIC
coiled coil region	1311	1415	N/A	INTRINSIC
DIL	1650	1755	7.48e-51	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000074157

SMART Domains

Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885

Domain	Start	End	E-Value	Type
MYSc	63	763	N/A	SMART
IQ	764	786	2.41e-4	SMART
IQ	787	809	7.7e-3	SMART
IQ	812	834	2.18e-2	SMART
IQ	835	857	1.72e0	SMART
IQ	860	882	7.52e-6	SMART
IQ	883	905	4.12e-3	SMART
low complexity region	1053	1065	N/A	INTRINSIC
coiled coil region	1140	1261	N/A	INTRINSIC
coiled coil region	1311	1415	N/A	INTRINSIC
DIL	1650	1755	7.48e-51	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000121875

SMART Domains

Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885

Domain	Start	End	E-Value	Type
MYSc	63	763	N/A	SMART
IQ	764	786	2.41e-4	SMART
IQ	787	809	7.7e-3	SMART
IQ	812	834	2.18e-2	SMART
IQ	835	857	1.72e0	SMART
IQ	860	882	7.52e-6	SMART
IQ	883	905	4.12e-3	SMART
low complexity region	1053	1065	N/A	INTRINSIC
coiled coil region	1140	1261	N/A	INTRINSIC
coiled coil region	1332	1441	N/A	INTRINSIC
DIL	1676	1781	7.48e-51	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000121875

SMART Domains

Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885

Domain	Start	End	E-Value	Type
MYSc	63	763	N/A	SMART
IQ	764	786	2.41e-4	SMART
IQ	787	809	7.7e-3	SMART
IQ	812	834	2.18e-2	SMART
IQ	835	857	1.72e0	SMART
IQ	860	882	7.52e-6	SMART
IQ	883	905	4.12e-3	SMART
low complexity region	1053	1065	N/A	INTRINSIC
coiled coil region	1140	1261	N/A	INTRINSIC
coiled coil region	1332	1441	N/A	INTRINSIC
DIL	1676	1781	7.48e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	G	A	16: 88,707,405	T168I	probably benign	Het
2410089E03Rik	C	T	15: 8,227,067	Q2004*	probably null	Het
Abtb2	T	A	2: 103,683,493		probably null	Het
Ankrd10	A	T	8: 11,615,769	V277E	probably benign	Het
Ankrd28	C	T	14: 31,715,264	V615I	probably benign	Het
Aqr	G	A	2: 114,114,593	P1079L	probably damaging	Het
Brox	G	A	1: 183,292,504	A60V	probably damaging	Het
Copg1	T	C	6: 87,894,169	V289A	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
D430042O09Rik	T	C	7: 125,795,250	L192P	probably damaging	Het
Dido1	T	C	2: 180,661,473	N1546S	probably benign	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmxl1	T	A	18: 49,859,270	I361N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fhod3	T	A	18: 24,754,317	D88E	probably benign	Het
Flywch1	A	G	17: 23,755,770	M632T	probably benign	Het
Henmt1	A	G	3: 108,958,597	T213A	probably benign	Het
Itga9	T	C	9: 118,698,446	V555A	probably benign	Het
Kif13b	C	T	14: 64,779,335	R1317*	probably null	Het
Kndc1	A	T	7: 139,895,260	E25V	probably damaging	Het
Lingo2	T	A	4: 35,708,675	D435V	possibly damaging	Het
Lrrc14b	T	A	13: 74,361,164	M375L	probably benign	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mgat4c	G	A	10: 102,389,070	V382I	probably benign	Het
Mpp6	T	C	6: 50,196,623	I489T	probably benign	Het
Muc16	T	C	9: 18,566,785	T7075A	possibly damaging	Het
Neb	T	C	2: 52,273,961	D1995G	possibly damaging	Het
Nudt9	T	C	5: 104,050,694	V75A	possibly damaging	Het
Olfr1277	C	T	2: 111,269,876	V164I	probably benign	Het
Paf1	T	C	7: 28,395,068	Y35H	probably damaging	Het
Panx3	T	A	9: 37,661,444	Q270L	possibly damaging	Het
Pde6h	G	T	6: 136,959,319	R20L	possibly damaging	Het
Pdxk	A	G	10: 78,445,006	I200T	probably benign	Het
Ppara	A	T	15: 85,798,191	M363L	probably damaging	Het
Prmt8	A	T	6: 127,689,883	L376*	probably null	Het
Serpina1a	G	C	12: 103,853,808	T393R	probably damaging	Het
Sfxn1	C	T	13: 54,093,022	R178C	probably damaging	Het
Sirpb1c	A	T	3: 15,848,395	W7R	possibly damaging	Het
Skint5	T	C	4: 113,942,660	Y104C	probably damaging	Het
Slamf6	A	T	1: 171,936,624	T195S	probably damaging	Het
Slc2a6	T	C	2: 27,024,202	D301G	probably benign	Het
Stab2	A	T	10: 86,883,782		probably null	Het
Tctn3	C	G	19: 40,611,336	D141H	probably damaging	Het
Tnik	A	G	3: 28,661,728	N1164D	probably damaging	Het
Tpcn1	C	T	5: 120,537,937	V711I	probably benign	Het
Trim11	G	A	11: 58,978,334	G32D	probably damaging	Het
Usp32	TTTGGTTG	TTTG	11: 85,019,855		probably null	Het
Vmn1r72	T	C	7: 11,669,784	I246V	probably benign	Het
Zfp362	G	T	4: 128,786,055	R273S	probably damaging	Het
Zfp715	T	C	7: 43,301,676	D66G	possibly damaging	Het

Other mutations in Myo5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00798:Myo5b	APN	18	74654076	splice site	probably benign
IGL01083:Myo5b	APN	18	74733903	splice site	probably benign
IGL01448:Myo5b	APN	18	74644090	missense	probably damaging	0.97
IGL01516:Myo5b	APN	18	74627195	missense	probably damaging	0.99
IGL01525:Myo5b	APN	18	74740549	missense	probably damaging	1.00
IGL01873:Myo5b	APN	18	74580396	missense	probably damaging	1.00
IGL01887:Myo5b	APN	18	74714936	missense	probably benign	0.41
IGL01953:Myo5b	APN	18	74569767	missense	possibly damaging	0.62
IGL01976:Myo5b	APN	18	74698277	missense	probably damaging	1.00
IGL02017:Myo5b	APN	18	74716999	missense	probably damaging	1.00
IGL02331:Myo5b	APN	18	74638040	critical splice acceptor site	probably null
IGL02624:Myo5b	APN	18	74714939	missense	probably damaging	0.98
IGL02707:Myo5b	APN	18	74695367	splice site	probably benign
IGL02806:Myo5b	APN	18	74617080	critical splice donor site	probably null
IGL03009:Myo5b	APN	18	74760968	missense	possibly damaging	0.54
IGL03061:Myo5b	APN	18	74634559	missense	probably benign	0.02
IGL03061:Myo5b	APN	18	74580544	splice site	probably benign
unrat	UTSW	18	74653361	missense	possibly damaging	0.93
BB007:Myo5b	UTSW	18	74731754	missense	probably benign
BB017:Myo5b	UTSW	18	74731754	missense	probably benign
R0085:Myo5b	UTSW	18	74701680	missense	probably benign	0.21
R0114:Myo5b	UTSW	18	74742171	missense	probably benign	0.03
R0226:Myo5b	UTSW	18	74742180	missense	probably benign
R0242:Myo5b	UTSW	18	74661716	missense	possibly damaging	0.95
R0242:Myo5b	UTSW	18	74661716	missense	possibly damaging	0.95
R0471:Myo5b	UTSW	18	74728954	splice site	probably benign
R0494:Myo5b	UTSW	18	74653967	missense	probably damaging	1.00
R0920:Myo5b	UTSW	18	74625641	missense	probably benign	0.09
R1144:Myo5b	UTSW	18	74625587	missense	probably damaging	1.00
R1177:Myo5b	UTSW	18	74644072	missense	probably damaging	1.00
R1387:Myo5b	UTSW	18	74644201	splice site	probably benign
R1468:Myo5b	UTSW	18	74740503	missense	probably damaging	0.99
R1468:Myo5b	UTSW	18	74740503	missense	probably damaging	0.99
R1555:Myo5b	UTSW	18	74569782	missense	probably damaging	1.00
R1587:Myo5b	UTSW	18	74733990	missense	probably benign
R1600:Myo5b	UTSW	18	74713540	unclassified	probably benign
R1639:Myo5b	UTSW	18	74707916	missense	probably benign	0.19
R1779:Myo5b	UTSW	18	74742147	missense	probably benign	0.06
R1806:Myo5b	UTSW	18	74577609	missense	possibly damaging	0.91
R1929:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2046:Myo5b	UTSW	18	74577455	missense	probably benign	0.28
R2093:Myo5b	UTSW	18	74759192	missense	probably damaging	0.98
R2270:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2272:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2298:Myo5b	UTSW	18	74625605	missense	probably damaging	1.00
R2433:Myo5b	UTSW	18	74759087	missense	probably damaging	1.00
R2888:Myo5b	UTSW	18	74762618	missense	probably damaging	1.00
R3824:Myo5b	UTSW	18	74661655	missense	probably benign	0.41
R3937:Myo5b	UTSW	18	74716037	missense	probably damaging	0.98
R3938:Myo5b	UTSW	18	74716037	missense	probably damaging	0.98
R3947:Myo5b	UTSW	18	74695403	missense	probably damaging	1.00
R3971:Myo5b	UTSW	18	74740527	missense	probably damaging	1.00
R3972:Myo5b	UTSW	18	74740527	missense	probably damaging	1.00
R3974:Myo5b	UTSW	18	74634481	missense	probably damaging	1.00
R4027:Myo5b	UTSW	18	74759240	missense	possibly damaging	0.67
R4080:Myo5b	UTSW	18	74740488	missense	probably benign
R4285:Myo5b	UTSW	18	74714849	missense	probably benign
R4308:Myo5b	UTSW	18	74731740	missense	possibly damaging	0.89
R4411:Myo5b	UTSW	18	74698274	missense	possibly damaging	0.89
R4415:Myo5b	UTSW	18	74580408	missense	probably damaging	1.00
R4516:Myo5b	UTSW	18	74625674	missense	probably damaging	1.00
R4690:Myo5b	UTSW	18	74722462	missense	probably damaging	0.97
R4781:Myo5b	UTSW	18	74744681	missense	possibly damaging	0.80
R4786:Myo5b	UTSW	18	74695380	missense	probably benign	0.01
R4796:Myo5b	UTSW	18	74744630	missense	possibly damaging	0.68
R4924:Myo5b	UTSW	18	74695384	missense	probably benign	0.19
R4972:Myo5b	UTSW	18	74627193	missense	probably damaging	0.98
R5004:Myo5b	UTSW	18	74744773	critical splice donor site	probably null
R5024:Myo5b	UTSW	18	74716034	missense	possibly damaging	0.90
R5043:Myo5b	UTSW	18	74638153	critical splice donor site	probably null
R5187:Myo5b	UTSW	18	74701674	missense	possibly damaging	0.68
R5232:Myo5b	UTSW	18	74714932	missense	probably damaging	0.99
R5254:Myo5b	UTSW	18	74700606	missense	possibly damaging	0.65
R5255:Myo5b	UTSW	18	74662670	missense	possibly damaging	0.94
R5715:Myo5b	UTSW	18	74742175	missense	possibly damaging	0.88
R5733:Myo5b	UTSW	18	74654057	missense	possibly damaging	0.93
R5797:Myo5b	UTSW	18	74701521	missense	probably benign
R5875:Myo5b	UTSW	18	74707902	splice site	probably null
R6088:Myo5b	UTSW	18	74720898	missense	possibly damaging	0.89
R6104:Myo5b	UTSW	18	74700679	missense	probably benign	0.19
R6237:Myo5b	UTSW	18	74742178	missense	probably damaging	1.00
R6265:Myo5b	UTSW	18	74577440	splice site	probably null
R6267:Myo5b	UTSW	18	74616991	missense	probably damaging	1.00
R6328:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6330:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6331:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6347:Myo5b	UTSW	18	74770385	missense	probably benign	0.11
R6479:Myo5b	UTSW	18	74617015	missense	probably damaging	1.00
R6748:Myo5b	UTSW	18	74701503	missense	possibly damaging	0.80
R6749:Myo5b	UTSW	18	74701503	missense	possibly damaging	0.80
R6750:Myo5b	UTSW	18	74617035	missense	possibly damaging	0.74
R6833:Myo5b	UTSW	18	74770325	missense	probably benign
R6876:Myo5b	UTSW	18	74707955	missense	probably benign
R6880:Myo5b	UTSW	18	74722430	missense	probably benign	0.02
R6902:Myo5b	UTSW	18	74676685	missense	possibly damaging	0.95
R6985:Myo5b	UTSW	18	74653361	missense	possibly damaging	0.93
R7039:Myo5b	UTSW	18	74701528	missense	probably benign	0.01
R7162:Myo5b	UTSW	18	74695427	missense	probably benign	0.02
R7345:Myo5b	UTSW	18	74708024	missense	possibly damaging	0.82
R7530:Myo5b	UTSW	18	74731731	missense	probably benign	0.00
R7564:Myo5b	UTSW	18	74634511	missense	possibly damaging	0.84
R7635:Myo5b	UTSW	18	74580396	missense	probably damaging	1.00
R7670:Myo5b	UTSW	18	74701446	missense	probably benign	0.05
R7754:Myo5b	UTSW	18	74634559	missense	probably benign	0.02
R7930:Myo5b	UTSW	18	74731754	missense	probably benign
R8013:Myo5b	UTSW	18	74760899	nonsense	probably null
R8271:Myo5b	UTSW	18	74627190	missense	probably damaging	1.00
R8312:Myo5b	UTSW	18	74733962	missense	probably damaging	1.00
R8383:Myo5b	UTSW	18	74643978	missense	probably benign	0.05
R8384:Myo5b	UTSW	18	74742202	missense	probably damaging	1.00
R8474:Myo5b	UTSW	18	74770340	missense	probably damaging	1.00
R8825:Myo5b	UTSW	18	74759098	missense	possibly damaging	0.79
R8846:Myo5b	UTSW	18	74707972	missense	probably benign	0.04
R9236:Myo5b	UTSW	18	74720863	missense	probably benign
R9283:Myo5b	UTSW	18	74644078	missense	probably benign	0.16
R9370:Myo5b	UTSW	18	74627175	missense	possibly damaging	0.54
R9506:Myo5b	UTSW	18	74744760	missense	possibly damaging	0.82
R9523:Myo5b	UTSW	18	74728897	missense	possibly damaging	0.89
R9622:Myo5b	UTSW	18	74714946	missense	probably damaging	0.99
R9676:Myo5b	UTSW	18	74759160	missense	probably benign	0.22
R9725:Myo5b	UTSW	18	74723770	missense	probably benign
RF009:Myo5b	UTSW	18	74643999	missense	probably damaging	1.00
Z1088:Myo5b	UTSW	18	74744749	missense	probably benign	0.35
Z1177:Myo5b	UTSW	18	74617017	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- CAGTTGAAATTGCAGGTGGC -3'
(R):5'- GGAAATTATGGTGAACCCTGC -3'

Sequencing Primer
(F):5'- CCTGAGAGAGGTGGCTTGTGC -3'
(R):5'- CTGCATTACTAACCTGCGGTAAGG -3'

Posted On

2019-10-24