Incidental Mutation 'R7629:Tctn3'
ID589575
Institutional Source Beutler Lab
Gene Symbol Tctn3
Ensembl Gene ENSMUSG00000025008
Gene Nametectonic family member 3
Synonyms4930521E07Rik, Tect3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7629 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location40596446-40612233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 40611336 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 141 (D141H)
Ref Sequence ENSEMBL: ENSMUSP00000025981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025981] [ENSMUST00000132452] [ENSMUST00000134063] [ENSMUST00000135795]
Predicted Effect probably damaging
Transcript: ENSMUST00000025981
AA Change: D141H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025981
Gene: ENSMUSG00000025008
AA Change: D141H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 6.3e-83 PFAM
low complexity region 578 590 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132452
AA Change: D141H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121760
Gene: ENSMUSG00000025008
AA Change: D141H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 364 3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134063
SMART Domains Protein: ENSMUSP00000116285
Gene: ENSMUSG00000048120

DomainStartEndE-ValueType
Pfam:GDA1_CD39 69 500 6.9e-170 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135795
AA Change: D141H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123461
Gene: ENSMUSG00000025008
AA Change: D141H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 2.5e-82 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Tctn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Tctn3 APN 19 40597421 missense probably damaging 0.99
IGL01326:Tctn3 APN 19 40597436 missense probably damaging 1.00
IGL01351:Tctn3 APN 19 40607637 missense probably benign 0.00
IGL01604:Tctn3 APN 19 40605302 splice site probably null
IGL01844:Tctn3 APN 19 40612137 missense probably damaging 0.99
IGL02469:Tctn3 APN 19 40597523 missense probably benign 0.01
FR4449:Tctn3 UTSW 19 40607202 intron probably benign
R0333:Tctn3 UTSW 19 40607267 missense possibly damaging 0.86
R0409:Tctn3 UTSW 19 40611416 splice site probably benign
R1573:Tctn3 UTSW 19 40608917 nonsense probably null
R2288:Tctn3 UTSW 19 40605713 missense probably damaging 1.00
R3792:Tctn3 UTSW 19 40611711 missense probably benign 0.00
R3916:Tctn3 UTSW 19 40607649 missense possibly damaging 0.68
R4033:Tctn3 UTSW 19 40597323 missense probably benign 0.23
R4728:Tctn3 UTSW 19 40605742 missense probably damaging 1.00
R5093:Tctn3 UTSW 19 40612104 missense probably damaging 0.99
R5253:Tctn3 UTSW 19 40607241 missense probably benign 0.25
R5334:Tctn3 UTSW 19 40602822 missense probably benign 0.16
R5620:Tctn3 UTSW 19 40608917 nonsense probably null
R6143:Tctn3 UTSW 19 40609227 missense probably benign 0.03
R6166:Tctn3 UTSW 19 40597479 missense possibly damaging 0.92
Z1088:Tctn3 UTSW 19 40607346 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGATTGCCAGGCTAAAGGTGC -3'
(R):5'- CCCTCTTATTGGCATCAGACATTG -3'

Sequencing Primer
(F):5'- CCAGGCTAAAGGTGCTGAGC -3'
(R):5'- ACATTGGTGGGGTAAGGCC -3'
Posted On2019-10-24