Incidental Mutation 'R7630:Cnga3'
ID589576
Institutional Source Beutler Lab
Gene Symbol Cnga3
Ensembl Gene ENSMUSG00000026114
Gene Namecyclic nucleotide gated channel alpha 3
SynonymsCNG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7630 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37214434-37263384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37258046 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 148 (D148G)
Ref Sequence ENSEMBL: ENSMUSP00000027288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027288] [ENSMUST00000194195] [ENSMUST00000195272]
Predicted Effect probably damaging
Transcript: ENSMUST00000027288
AA Change: D148G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027288
Gene: ENSMUSG00000026114
AA Change: D148G

DomainStartEndE-ValueType
Pfam:Ion_trans 109 351 1.3e-30 PFAM
cNMP 423 547 2.5e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000194195
AA Change: D148G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142075
Gene: ENSMUSG00000026114
AA Change: D148G

DomainStartEndE-ValueType
Pfam:Ion_trans 146 340 1.3e-15 PFAM
cNMP 423 547 2.4e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000195272
AA Change: D186G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142175
Gene: ENSMUSG00000026114
AA Change: D186G

DomainStartEndE-ValueType
Pfam:Ion_trans 184 378 1.5e-15 PFAM
cNMP 461 585 2.4e-28 SMART
PDB:3SWY|C 605 648 3e-14 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals experience progressive loss of cone photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Agbl1 A T 7: 76,886,156 I1019F unknown Het
Arhgap15 A G 2: 43,780,636 T11A probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atg2b T C 12: 105,646,954 probably null Het
Aup1 C A 6: 83,054,923 D50E unknown Het
Ccl25 A G 8: 4,353,955 Y49C probably damaging Het
Cpeb3 A T 19: 37,054,293 F570I probably damaging Het
Cyp3a16 T A 5: 145,436,310 probably null Het
Eif2d C T 1: 131,154,366 T65M probably benign Het
Fryl T C 5: 73,110,245 I426V possibly damaging Het
Hgf T C 5: 16,598,250 S387P probably benign Het
Hyal6 T C 6: 24,734,584 V172A probably damaging Het
Il10ra T C 9: 45,256,071 D396G probably damaging Het
Kif26a A G 12: 112,175,697 D795G probably damaging Het
Lrrc8c T A 5: 105,607,702 S448T probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Notch2 A G 3: 98,137,508 D1582G possibly damaging Het
Olfr296-ps1 T C 7: 86,562,472 S247P probably damaging Het
Olfr364-ps1 A C 2: 37,146,359 D49A probably damaging Het
Osmr T C 15: 6,816,971 I741V possibly damaging Het
Park2 A G 17: 11,237,568 E93G probably benign Het
Plec C T 15: 76,190,616 probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Rexo4 A T 2: 26,960,610 F247I probably damaging Het
Rph3a T C 5: 120,943,050 D628G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Scnn1g T C 7: 121,760,481 S396P probably damaging Het
Slc1a5 G A 7: 16,795,807 V384M probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Synpo2 A G 3: 123,080,032 V1154A probably damaging Het
Tanc2 T C 11: 105,776,908 V105A probably benign Het
Tapbp T C 17: 33,920,344 S105P probably benign Het
Tmem5 T C 10: 122,095,960 I103V possibly damaging Het
Tmem79 T C 3: 88,333,461 E60G possibly damaging Het
Txnrd2 A G 16: 18,438,390 D152G possibly damaging Het
Vcl T A 14: 20,983,402 L142* probably null Het
Vmn2r58 T C 7: 41,864,187 Y344C probably damaging Het
Vmn2r-ps117 A G 17: 18,824,647 D442G probably benign Het
Xpo6 A T 7: 126,140,389 probably null Het
Other mutations in Cnga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Cnga3 APN 1 37260793 missense possibly damaging 0.89
IGL01677:Cnga3 APN 1 37244918 nonsense probably null
IGL02475:Cnga3 APN 1 37257991 critical splice acceptor site probably null
IGL03145:Cnga3 APN 1 37261674 missense probably damaging 1.00
R1557:Cnga3 UTSW 1 37260985 missense probably damaging 1.00
R1622:Cnga3 UTSW 1 37244828 splice site probably benign
R1678:Cnga3 UTSW 1 37261498 missense possibly damaging 0.94
R1938:Cnga3 UTSW 1 37261873 missense possibly damaging 0.95
R2968:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R2969:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R3406:Cnga3 UTSW 1 37262065 missense probably benign 0.00
R3694:Cnga3 UTSW 1 37261740 missense probably damaging 1.00
R4079:Cnga3 UTSW 1 37241865 missense possibly damaging 0.70
R4850:Cnga3 UTSW 1 37258006 nonsense probably null
R4907:Cnga3 UTSW 1 37241942 critical splice donor site probably null
R5802:Cnga3 UTSW 1 37260925 missense probably damaging 0.98
R6135:Cnga3 UTSW 1 37232237 start gained probably benign
R6586:Cnga3 UTSW 1 37261278 missense probably damaging 0.99
R6997:Cnga3 UTSW 1 37244884 missense probably benign 0.34
R7799:Cnga3 UTSW 1 37261771 missense probably damaging 1.00
R8552:Cnga3 UTSW 1 37244979 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGGCAGGTGTAACCCTG -3'
(R):5'- AGCACCCACTCTGTGTTTG -3'

Sequencing Primer
(F):5'- TGTAACCCTGCAGGAATAATGGCC -3'
(R):5'- TCTCAGGCACCTCTTGGTCAAAG -3'
Posted On2019-10-24