Incidental Mutation 'R0055:Slc4a4'
ID58959
Institutional Source Beutler Lab
Gene Symbol Slc4a4
Ensembl Gene ENSMUSG00000060961
Gene Namesolute carrier family 4 (anion exchanger), member 4
SynonymsNBC1, NBC
MMRRC Submission 038349-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0055 (G1)
Quality Score194
Status Validated
Chromosome5
Chromosomal Location88886818-89239653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89156336 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 502 (H502P)
Ref Sequence ENSEMBL: ENSMUSP00000118413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]
Predicted Effect probably benign
Transcript: ENSMUST00000113218
AA Change: H537P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: H537P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 379 1.1e-100 PFAM
low complexity region 408 423 N/A INTRINSIC
Pfam:HCO3_cotransp 426 947 3e-246 PFAM
transmembrane domain 953 975 N/A INTRINSIC
low complexity region 999 1015 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130041
AA Change: H502P

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: H502P

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 344 1.5e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
Pfam:HCO3_cotransp 391 912 2.7e-246 PFAM
transmembrane domain 918 940 N/A INTRINSIC
low complexity region 964 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148750
AA Change: H546P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: H546P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 3.7e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 435 956 7.3e-246 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156238
AA Change: H546P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: H546P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 4.6e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 436 956 4.1e-231 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,968,161 S108R probably damaging Het
2010300C02Rik A C 1: 37,624,256 S854A probably benign Het
2210016F16Rik T C 13: 58,384,166 D192G probably damaging Het
4921501E09Rik A T 17: 33,066,722 W369R probably damaging Het
A2ml1 T C 6: 128,570,094 probably benign Het
Atp6v1h A T 1: 5,084,454 T2S probably benign Het
Bcl11b G A 12: 107,965,777 P179S probably benign Het
Cacna1a C T 8: 84,580,058 probably benign Het
Ccdc146 C T 5: 21,297,006 probably null Het
Ccdc61 T C 7: 18,892,536 D128G probably damaging Het
Cd55 A G 1: 130,459,576 probably benign Het
Cdk7 C A 13: 100,719,304 E99* probably null Het
Cox8a A T 19: 7,217,509 S2T probably damaging Het
Dennd5a A G 7: 109,899,791 I955T possibly damaging Het
Dopey1 A C 9: 86,512,652 E602A probably benign Het
Ephx4 T C 5: 107,413,078 L32S probably damaging Het
Fbxo21 T A 5: 118,000,490 D493E probably benign Het
Frmd4b A T 6: 97,323,649 probably benign Het
Fzd1 A T 5: 4,756,037 M515K possibly damaging Het
Gli2 A G 1: 118,890,408 probably benign Het
Gm12887 T A 4: 121,616,469 K61N probably damaging Het
Grin2a A T 16: 9,669,807 V409D probably damaging Het
Grin2b T C 6: 135,923,203 I227V probably benign Het
Helz2 T G 2: 181,228,821 D2879A possibly damaging Het
Itpr2 T C 6: 146,323,133 N1453S probably benign Het
Itpr3 C A 17: 27,098,322 S817Y probably damaging Het
Lin7c T A 2: 109,896,453 probably benign Het
Ly75 T C 2: 60,321,918 E1097G probably benign Het
Mcm10 T C 2: 4,991,407 N882D probably damaging Het
Mettl13 A T 1: 162,546,181 L167Q probably damaging Het
Morn2 A T 17: 80,295,513 M1L probably benign Het
Mybph G T 1: 134,193,852 V88L probably damaging Het
Nefm T A 14: 68,121,199 probably benign Het
Nf1 A G 11: 79,471,551 E1497G probably damaging Het
Olfr1281 T A 2: 111,328,525 Y35* probably null Het
Olfr137 T C 17: 38,304,811 S217G possibly damaging Het
Olfr615 A G 7: 103,561,037 K187E probably damaging Het
Olfr670 T A 7: 104,960,496 T79S possibly damaging Het
Plcd3 C G 11: 103,077,585 W382S probably damaging Het
Plxna1 T A 6: 89,329,739 I1370F possibly damaging Het
Rarb G A 14: 16,509,066 R106C probably damaging Het
Rps6ka5 G A 12: 100,678,580 T37I probably damaging Het
Runx1 G T 16: 92,644,141 probably benign Het
Scube1 A G 15: 83,634,736 V301A probably damaging Het
Sema3a A T 5: 13,400,037 N27I possibly damaging Het
Slc15a3 G T 19: 10,843,042 E8* probably null Het
Slc22a5 T C 11: 53,891,206 S112G probably benign Het
Slc25a45 T C 19: 5,880,467 F3L probably damaging Het
Slfn10-ps A G 11: 83,030,300 noncoding transcript Het
Slit2 C A 5: 48,281,726 C1077* probably null Het
Spn A G 7: 127,136,322 F82L possibly damaging Het
Tbccd1 A G 16: 22,841,905 W54R probably damaging Het
Ucp1 G T 8: 83,290,604 E8* probably null Het
Unc80 A T 1: 66,506,623 probably benign Het
Vsnl1 A T 12: 11,386,986 probably null Het
Zdhhc11 C T 13: 73,982,686 Q295* probably null Het
Zfp457 T A 13: 67,294,034 H63L probably damaging Het
Other mutations in Slc4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Slc4a4 APN 5 89179686 missense probably benign 0.01
IGL00976:Slc4a4 APN 5 88954798 missense probably damaging 1.00
IGL01074:Slc4a4 APN 5 89179774 missense probably damaging 1.00
IGL01120:Slc4a4 APN 5 89132379 missense probably damaging 1.00
IGL01284:Slc4a4 APN 5 89129673 missense probably benign 0.22
IGL01375:Slc4a4 APN 5 89179734 missense probably damaging 1.00
IGL01399:Slc4a4 APN 5 89228935 missense probably damaging 1.00
IGL01487:Slc4a4 APN 5 89228856 missense probably benign 0.19
IGL02501:Slc4a4 APN 5 89129649 missense probably benign 0.13
IGL03104:Slc4a4 APN 5 89149372 missense probably damaging 1.00
IGL03157:Slc4a4 APN 5 89156513 missense probably damaging 0.99
IGL03205:Slc4a4 APN 5 89149330 missense probably benign 0.00
IGL03356:Slc4a4 APN 5 89122483 missense probably benign 0.00
IGL03372:Slc4a4 APN 5 89156426 missense probably damaging 1.00
IGL03382:Slc4a4 APN 5 89228836 missense probably damaging 1.00
camera UTSW 5 89132507 missense probably damaging 1.00
pixels UTSW 5 89122403 missense probably damaging 0.99
Shutter UTSW 5 89225948 missense probably damaging 1.00
Tetrapod UTSW 5 89228972 missense probably damaging 1.00
tripod UTSW 5 89149333 missense possibly damaging 0.52
BB008:Slc4a4 UTSW 5 89170781 missense probably benign 0.00
BB018:Slc4a4 UTSW 5 89170781 missense probably benign 0.00
PIT4515001:Slc4a4 UTSW 5 89133253 missense probably damaging 1.00
PIT4544001:Slc4a4 UTSW 5 89038543 missense probably damaging 1.00
R0007:Slc4a4 UTSW 5 89038578 missense probably damaging 1.00
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0054:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0230:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0632:Slc4a4 UTSW 5 89129641 missense probably damaging 1.00
R1199:Slc4a4 UTSW 5 89215794 critical splice donor site probably null
R1597:Slc4a4 UTSW 5 89135728 missense probably benign 0.01
R1783:Slc4a4 UTSW 5 89132414 missense probably damaging 1.00
R1813:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R1896:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R2000:Slc4a4 UTSW 5 89028347 missense probably damaging 1.00
R2139:Slc4a4 UTSW 5 89046264 missense probably damaging 1.00
R2163:Slc4a4 UTSW 5 89214576 missense probably damaging 1.00
R2513:Slc4a4 UTSW 5 89156398 missense probably benign 0.00
R2873:Slc4a4 UTSW 5 89135764 missense probably damaging 1.00
R2995:Slc4a4 UTSW 5 88934814 missense probably damaging 1.00
R3054:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89132507 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3056:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3617:Slc4a4 UTSW 5 89234804 missense probably benign 0.00
R3856:Slc4a4 UTSW 5 89232839 missense probably benign 0.00
R3863:Slc4a4 UTSW 5 89135648 missense possibly damaging 0.95
R3896:Slc4a4 UTSW 5 89197766 splice site probably benign
R4007:Slc4a4 UTSW 5 89214593 missense probably damaging 1.00
R4616:Slc4a4 UTSW 5 89038561 missense probably damaging 1.00
R4740:Slc4a4 UTSW 5 89225894 missense probably damaging 1.00
R5009:Slc4a4 UTSW 5 89149298 critical splice acceptor site probably null
R5119:Slc4a4 UTSW 5 88954862 missense probably null 0.97
R5228:Slc4a4 UTSW 5 89156525 missense possibly damaging 0.50
R5394:Slc4a4 UTSW 5 89197764 critical splice donor site probably null
R5396:Slc4a4 UTSW 5 89046217 missense probably benign 0.00
R5662:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R5664:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R6021:Slc4a4 UTSW 5 89040402 intron probably benign
R6088:Slc4a4 UTSW 5 89197704 missense probably benign 0.12
R6337:Slc4a4 UTSW 5 89046372 missense probably benign 0.21
R6416:Slc4a4 UTSW 5 89179729 missense probably benign 0.26
R6452:Slc4a4 UTSW 5 89228980 missense probably benign 0.05
R6524:Slc4a4 UTSW 5 89232764 missense probably benign 0.01
R6566:Slc4a4 UTSW 5 89149333 missense possibly damaging 0.52
R6727:Slc4a4 UTSW 5 89170765 missense probably benign 0.00
R6844:Slc4a4 UTSW 5 89228972 missense probably damaging 1.00
R6970:Slc4a4 UTSW 5 89179831 missense probably damaging 0.98
R7021:Slc4a4 UTSW 5 89040346 splice site probably null
R7180:Slc4a4 UTSW 5 89046236 missense probably damaging 0.97
R7197:Slc4a4 UTSW 5 88934574 intron probably benign
R7246:Slc4a4 UTSW 5 89122403 missense probably damaging 0.99
R7309:Slc4a4 UTSW 5 89170751 missense probably benign
R7412:Slc4a4 UTSW 5 89214647 splice site probably null
R7492:Slc4a4 UTSW 5 89129650 missense possibly damaging 0.92
R7561:Slc4a4 UTSW 5 89199697 missense probably damaging 1.00
R7577:Slc4a4 UTSW 5 89225867 missense probably damaging 0.97
R7609:Slc4a4 UTSW 5 89135686 missense probably damaging 1.00
R7781:Slc4a4 UTSW 5 89228932 missense possibly damaging 0.78
R7931:Slc4a4 UTSW 5 89170781 missense probably benign 0.00
R7950:Slc4a4 UTSW 5 89058278 splice site probably null
R8078:Slc4a4 UTSW 5 89179707 missense probably benign 0.00
R8313:Slc4a4 UTSW 5 89046263 missense possibly damaging 0.84
R8332:Slc4a4 UTSW 5 89179821 missense probably benign 0.11
R8534:Slc4a4 UTSW 5 89135722 missense probably damaging 1.00
Z1177:Slc4a4 UTSW 5 89132459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- gcttccacctcagAAGTTATTATTGAAAGCA -3'
(R):5'- GCTCACCAGAATTAAACTAAAAGGTCCCA -3'

Sequencing Primer
(F):5'- TTGAAAGCAATAATTAGTGACCCCC -3'
(R):5'- TGTACTGCAACTGTGCAAAC -3'
Posted On2013-07-11