Incidental Mutation 'R7630:Rph3a'
ID589590
Institutional Source Beutler Lab
Gene Symbol Rph3a
Ensembl Gene ENSMUSG00000029608
Gene Namerabphilin 3A
Synonyms2900002P20Rik, Doc2 family
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7630 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120940499-121010092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120943050 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 628 (D628G)
Ref Sequence ENSEMBL: ENSMUSP00000078198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079204] [ENSMUST00000202326] [ENSMUST00000202406]
PDB Structure
Structural determinants for Ca2+ and PIP2 binding by the C2A domain of rabphilin-3A [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000079204
AA Change: D628G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078198
Gene: ENSMUSG00000029608
AA Change: D628G

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202326
AA Change: D628G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144291
Gene: ENSMUSG00000029608
AA Change: D628G

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202406
AA Change: D628G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143917
Gene: ENSMUSG00000029608
AA Change: D628G

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an effector for RAB3A, which is a small G protein that acts in the late stages of neurotransmitter exocytosis. The encoded protein may be involved in neurotransmitter release and synaptic vesicle traffic. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutants are viable and fertile and do not exhibit any obvious abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Agbl1 A T 7: 76,886,156 I1019F unknown Het
Arhgap15 A G 2: 43,780,636 T11A probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atg2b T C 12: 105,646,954 probably null Het
Aup1 C A 6: 83,054,923 D50E unknown Het
Ccl25 A G 8: 4,353,955 Y49C probably damaging Het
Cnga3 A G 1: 37,258,046 D148G probably damaging Het
Cpeb3 A T 19: 37,054,293 F570I probably damaging Het
Cyp3a16 T A 5: 145,436,310 probably null Het
Eif2d C T 1: 131,154,366 T65M probably benign Het
Fryl T C 5: 73,110,245 I426V possibly damaging Het
Hgf T C 5: 16,598,250 S387P probably benign Het
Hyal6 T C 6: 24,734,584 V172A probably damaging Het
Il10ra T C 9: 45,256,071 D396G probably damaging Het
Kif26a A G 12: 112,175,697 D795G probably damaging Het
Lrrc8c T A 5: 105,607,702 S448T probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Notch2 A G 3: 98,137,508 D1582G possibly damaging Het
Olfr296-ps1 T C 7: 86,562,472 S247P probably damaging Het
Olfr364-ps1 A C 2: 37,146,359 D49A probably damaging Het
Osmr T C 15: 6,816,971 I741V possibly damaging Het
Park2 A G 17: 11,237,568 E93G probably benign Het
Plec C T 15: 76,190,616 probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Rexo4 A T 2: 26,960,610 F247I probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Scnn1g T C 7: 121,760,481 S396P probably damaging Het
Slc1a5 G A 7: 16,795,807 V384M probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Synpo2 A G 3: 123,080,032 V1154A probably damaging Het
Tanc2 T C 11: 105,776,908 V105A probably benign Het
Tapbp T C 17: 33,920,344 S105P probably benign Het
Tmem5 T C 10: 122,095,960 I103V possibly damaging Het
Tmem79 T C 3: 88,333,461 E60G possibly damaging Het
Txnrd2 A G 16: 18,438,390 D152G possibly damaging Het
Vcl T A 14: 20,983,402 L142* probably null Het
Vmn2r58 T C 7: 41,864,187 Y344C probably damaging Het
Vmn2r-ps117 A G 17: 18,824,647 D442G probably benign Het
Xpo6 A T 7: 126,140,389 probably null Het
Other mutations in Rph3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Rph3a APN 5 120948833 missense probably damaging 1.00
IGL02383:Rph3a APN 5 120963939 missense probably damaging 1.00
IGL02394:Rph3a APN 5 120946348 splice site probably null
IGL02429:Rph3a APN 5 120980124 splice site probably null
IGL02825:Rph3a APN 5 120945446 missense possibly damaging 0.94
R0282:Rph3a UTSW 5 120963910 nonsense probably null
R0325:Rph3a UTSW 5 120943064 missense probably benign 0.22
R0402:Rph3a UTSW 5 120942254 missense probably damaging 0.99
R0648:Rph3a UTSW 5 120959270 missense possibly damaging 0.77
R1807:Rph3a UTSW 5 120945393 missense probably damaging 0.99
R2273:Rph3a UTSW 5 120973304 missense probably damaging 0.98
R2519:Rph3a UTSW 5 120954422 missense probably damaging 1.00
R2865:Rph3a UTSW 5 120947927 missense probably damaging 1.00
R2939:Rph3a UTSW 5 120980149 splice site probably benign
R3153:Rph3a UTSW 5 120973377 missense probably damaging 1.00
R4289:Rph3a UTSW 5 120973305 missense probably damaging 1.00
R4775:Rph3a UTSW 5 120954488 missense probably benign 0.00
R4949:Rph3a UTSW 5 120963834 missense probably damaging 1.00
R4997:Rph3a UTSW 5 120963843 missense probably damaging 0.96
R5008:Rph3a UTSW 5 120945391 missense probably damaging 1.00
R5027:Rph3a UTSW 5 120954449 missense possibly damaging 0.90
R5155:Rph3a UTSW 5 120948770 missense possibly damaging 0.94
R5497:Rph3a UTSW 5 120942190 missense probably benign 0.28
R5931:Rph3a UTSW 5 120963873 missense probably damaging 0.99
R6273:Rph3a UTSW 5 120945422 missense possibly damaging 0.91
R7664:Rph3a UTSW 5 120961276 missense probably benign
Z1177:Rph3a UTSW 5 120942266 nonsense probably null
Z1177:Rph3a UTSW 5 120961275 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATGGGATCCAAGTCAGGACC -3'
(R):5'- ATGTCCTAAGGAGCTCTGTTG -3'

Sequencing Primer
(F):5'- AGGTATCCTCTTCTGGGA -3'
(R):5'- TCTGTTGGAGAGACAGGCC -3'
Posted On2019-10-24