Incidental Mutation 'R7630:Olfr296-ps1'
ID589597
Institutional Source Beutler Lab
Gene Symbol Olfr296-ps1
Ensembl Gene ENSMUSG00000092372
Gene Nameolfactory receptor 296, pseudogene 1
SynonymsMOR220-5_p, GA_x6K02T2NHDJ-9553029-9552092
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7630 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86561734-86562659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86562472 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 247 (S247P)
Ref Sequence ENSEMBL: ENSMUSP00000148154 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000173904
AA Change: S247P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4858 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Agbl1 A T 7: 76,886,156 I1019F unknown Het
Arhgap15 A G 2: 43,780,636 T11A probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atg2b T C 12: 105,646,954 probably null Het
Aup1 C A 6: 83,054,923 D50E unknown Het
Ccl25 A G 8: 4,353,955 Y49C probably damaging Het
Cnga3 A G 1: 37,258,046 D148G probably damaging Het
Cpeb3 A T 19: 37,054,293 F570I probably damaging Het
Cyp3a16 T A 5: 145,436,310 probably null Het
Eif2d C T 1: 131,154,366 T65M probably benign Het
Fryl T C 5: 73,110,245 I426V possibly damaging Het
Hgf T C 5: 16,598,250 S387P probably benign Het
Hyal6 T C 6: 24,734,584 V172A probably damaging Het
Il10ra T C 9: 45,256,071 D396G probably damaging Het
Kif26a A G 12: 112,175,697 D795G probably damaging Het
Lrrc8c T A 5: 105,607,702 S448T probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Notch2 A G 3: 98,137,508 D1582G possibly damaging Het
Olfr364-ps1 A C 2: 37,146,359 D49A probably damaging Het
Osmr T C 15: 6,816,971 I741V possibly damaging Het
Park2 A G 17: 11,237,568 E93G probably benign Het
Plec C T 15: 76,190,616 probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Rexo4 A T 2: 26,960,610 F247I probably damaging Het
Rph3a T C 5: 120,943,050 D628G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Scnn1g T C 7: 121,760,481 S396P probably damaging Het
Slc1a5 G A 7: 16,795,807 V384M probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Synpo2 A G 3: 123,080,032 V1154A probably damaging Het
Tanc2 T C 11: 105,776,908 V105A probably benign Het
Tapbp T C 17: 33,920,344 S105P probably benign Het
Tmem5 T C 10: 122,095,960 I103V possibly damaging Het
Tmem79 T C 3: 88,333,461 E60G possibly damaging Het
Txnrd2 A G 16: 18,438,390 D152G possibly damaging Het
Vcl T A 14: 20,983,402 L142* probably null Het
Vmn2r58 T C 7: 41,864,187 Y344C probably damaging Het
Vmn2r-ps117 A G 17: 18,824,647 D442G probably benign Het
Xpo6 A T 7: 126,140,389 probably null Het
Other mutations in Olfr296-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6272:Olfr296-ps1 UTSW 7 86561873 missense unknown
R8679:Olfr296-ps1 UTSW 7 86561939 missense unknown
Z1177:Olfr296-ps1 UTSW 7 86562568 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGCTTTCTTGCACTGACAC -3'
(R):5'- ATGCTTTGATGCACATGCG -3'

Sequencing Primer
(F):5'- TTGCACTGACACCTTTATCAAC -3'
(R):5'- CTTTGATGCACATGCGTTTATTTG -3'
Posted On2019-10-24