Mutagenetix > Incidental Mutation

Incidental Mutation 'R7630:Scnn1g'

589599

Institutional Source

Beutler Lab

Gene Symbol

Scnn1g

Ensembl Gene

ENSMUSG00000000216

Gene Name

sodium channel, nonvoltage-gated 1 gamma

Synonyms

ENaC gamma

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R7630 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121734479-121768475 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121760481 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 396 (S396P)

Ref Sequence

ENSEMBL: ENSMUSP00000000221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000221]

AlphaFold

Q9WU39

Predicted Effect

probably damaging
Transcript: ENSMUST00000000221
AA Change: S396P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: S396P

Domain	Start	End	E-Value	Type
Pfam:ASC	32	558	6.4e-91	PFAM
low complexity region	618	631	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

93% (40/43)

MGI Phenotype

FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530084C06Rik	G	T	13: 31,558,995	R92S	unknown	Het
Agbl1	A	T	7: 76,886,156	I1019F	unknown	Het
Arhgap15	A	G	2: 43,780,636	T11A	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atg2b	T	C	12: 105,646,954		probably null	Het
Aup1	C	A	6: 83,054,923	D50E	unknown	Het
Ccl25	A	G	8: 4,353,955	Y49C	probably damaging	Het
Cnga3	A	G	1: 37,258,046	D148G	probably damaging	Het
Cpeb3	A	T	19: 37,054,293	F570I	probably damaging	Het
Cyp3a16	T	A	5: 145,436,310		probably null	Het
Eif2d	C	T	1: 131,154,366	T65M	probably benign	Het
Fryl	T	C	5: 73,110,245	I426V	possibly damaging	Het
Hgf	T	C	5: 16,598,250	S387P	probably benign	Het
Hyal6	T	C	6: 24,734,584	V172A	probably damaging	Het
Il10ra	T	C	9: 45,256,071	D396G	probably damaging	Het
Kif26a	A	G	12: 112,175,697	D795G	probably damaging	Het
Lrrc8c	T	A	5: 105,607,702	S448T	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Notch2	A	G	3: 98,137,508	D1582G	possibly damaging	Het
Olfr296-ps1	T	C	7: 86,562,472	S247P	probably damaging	Het
Olfr364-ps1	A	C	2: 37,146,359	D49A	probably damaging	Het
Osmr	T	C	15: 6,816,971	I741V	possibly damaging	Het
Park2	A	G	17: 11,237,568	E93G	probably benign	Het
Plec	C	T	15: 76,190,616		probably null	Het
Prkag3	A	G	1: 74,744,735	F330L	probably damaging	Het
Rexo4	A	T	2: 26,960,610	F247I	probably damaging	Het
Rph3a	T	C	5: 120,943,050	D628G	probably damaging	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Slc1a5	G	A	7: 16,795,807	V384M	probably damaging	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Smc4	CTA	CTATA	3: 69,018,067		probably benign	Het
Synpo2	A	G	3: 123,080,032	V1154A	probably damaging	Het
Tanc2	T	C	11: 105,776,908	V105A	probably benign	Het
Tapbp	T	C	17: 33,920,344	S105P	probably benign	Het
Tmem5	T	C	10: 122,095,960	I103V	possibly damaging	Het
Tmem79	T	C	3: 88,333,461	E60G	possibly damaging	Het
Txnrd2	A	G	16: 18,438,390	D152G	possibly damaging	Het
Vcl	T	A	14: 20,983,402	L142*	probably null	Het
Vmn2r58	T	C	7: 41,864,187	Y344C	probably damaging	Het
Vmn2r-ps117	A	G	17: 18,824,647	D442G	probably benign	Het
Xpo6	A	T	7: 126,140,389		probably null	Het

Other mutations in Scnn1g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Scnn1g	APN	7	121740437	missense	probably benign	0.00
IGL01824:Scnn1g	APN	7	121766293	missense	probably benign	0.00
IGL02133:Scnn1g	APN	7	121743699	missense	probably damaging	1.00
IGL02529:Scnn1g	APN	7	121742446	splice site	probably benign
IGL02814:Scnn1g	APN	7	121740365	missense	probably damaging	1.00
IGL03091:Scnn1g	APN	7	121746683	missense	probably damaging	1.00
IGL03253:Scnn1g	APN	7	121737933	nonsense	probably null
PIT4504001:Scnn1g	UTSW	7	121742331	missense	probably benign	0.30
R0230:Scnn1g	UTSW	7	121746761	splice site	probably benign
R0324:Scnn1g	UTSW	7	121740555	missense	possibly damaging	0.62
R0367:Scnn1g	UTSW	7	121746579	splice site	probably benign
R0534:Scnn1g	UTSW	7	121767424	missense	probably benign	0.00
R1747:Scnn1g	UTSW	7	121760463	missense	probably damaging	0.99
R2004:Scnn1g	UTSW	7	121738188	nonsense	probably null
R2197:Scnn1g	UTSW	7	121767296	missense	probably damaging	1.00
R4396:Scnn1g	UTSW	7	121740427	missense	probably benign	0.01
R4804:Scnn1g	UTSW	7	121763080	frame shift	probably null
R4805:Scnn1g	UTSW	7	121746602	missense	probably damaging	1.00
R5219:Scnn1g	UTSW	7	121766266	missense	probably damaging	1.00
R5757:Scnn1g	UTSW	7	121738215	missense	probably damaging	1.00
R5882:Scnn1g	UTSW	7	121767358	missense	possibly damaging	0.79
R5910:Scnn1g	UTSW	7	121738095	missense	probably damaging	0.99
R6381:Scnn1g	UTSW	7	121767499	missense	probably benign	0.00
R6666:Scnn1g	UTSW	7	121767388	missense	probably benign	0.00
R6735:Scnn1g	UTSW	7	121742263	missense	probably benign	0.02
R6813:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6860:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6887:Scnn1g	UTSW	7	121760444	missense	probably benign	0.01
R7289:Scnn1g	UTSW	7	121738081	nonsense	probably null
R7488:Scnn1g	UTSW	7	121763434	missense	probably benign	0.00
R7888:Scnn1g	UTSW	7	121743655	missense	probably damaging	0.97
R7917:Scnn1g	UTSW	7	121743693	missense	probably damaging	1.00
R9051:Scnn1g	UTSW	7	121742343	missense	possibly damaging	0.86
R9312:Scnn1g	UTSW	7	121740595	missense	probably benign	0.00
Z1177:Scnn1g	UTSW	7	121760475	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAGTGTCTCACTGGCCATC -3'
(R):5'- TGTTCCACACAAACCTCAGTG -3'

Sequencing Primer
(F):5'- GGATTTCCCAGTGTCTACAACTG -3'
(R):5'- CCTCAGTGAATCAATTAAGCTCTGG -3'

Posted On

2019-10-24