Incidental Mutation 'R7630:Tmem5'
ID589603
Institutional Source Beutler Lab
Gene Symbol Tmem5
Ensembl Gene ENSMUSG00000034620
Gene Nametransmembrane protein 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7630 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location122078114-122097371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122095960 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 103 (I103V)
Ref Sequence ENSEMBL: ENSMUSP00000119308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038772] [ENSMUST00000140299]
Predicted Effect probably benign
Transcript: ENSMUST00000038772
Predicted Effect possibly damaging
Transcript: ENSMUST00000140299
AA Change: I103V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119308
Gene: ENSMUSG00000034620
AA Change: I103V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
Meta Mutation Damage Score 0.1525 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane protein that is thought to have glycosyltransferase function. Mutations in this gene result in cobblestone lissencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Agbl1 A T 7: 76,886,156 I1019F unknown Het
Arhgap15 A G 2: 43,780,636 T11A probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atg2b T C 12: 105,646,954 probably null Het
Aup1 C A 6: 83,054,923 D50E unknown Het
Ccl25 A G 8: 4,353,955 Y49C probably damaging Het
Cnga3 A G 1: 37,258,046 D148G probably damaging Het
Cpeb3 A T 19: 37,054,293 F570I probably damaging Het
Cyp3a16 T A 5: 145,436,310 probably null Het
Eif2d C T 1: 131,154,366 T65M probably benign Het
Fryl T C 5: 73,110,245 I426V possibly damaging Het
Hgf T C 5: 16,598,250 S387P probably benign Het
Hyal6 T C 6: 24,734,584 V172A probably damaging Het
Il10ra T C 9: 45,256,071 D396G probably damaging Het
Kif26a A G 12: 112,175,697 D795G probably damaging Het
Lrrc8c T A 5: 105,607,702 S448T probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Notch2 A G 3: 98,137,508 D1582G possibly damaging Het
Olfr296-ps1 T C 7: 86,562,472 S247P probably damaging Het
Olfr364-ps1 A C 2: 37,146,359 D49A probably damaging Het
Osmr T C 15: 6,816,971 I741V possibly damaging Het
Park2 A G 17: 11,237,568 E93G probably benign Het
Plec C T 15: 76,190,616 probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Rexo4 A T 2: 26,960,610 F247I probably damaging Het
Rph3a T C 5: 120,943,050 D628G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Scnn1g T C 7: 121,760,481 S396P probably damaging Het
Slc1a5 G A 7: 16,795,807 V384M probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Synpo2 A G 3: 123,080,032 V1154A probably damaging Het
Tanc2 T C 11: 105,776,908 V105A probably benign Het
Tapbp T C 17: 33,920,344 S105P probably benign Het
Tmem79 T C 3: 88,333,461 E60G possibly damaging Het
Txnrd2 A G 16: 18,438,390 D152G possibly damaging Het
Vcl T A 14: 20,983,402 L142* probably null Het
Vmn2r58 T C 7: 41,864,187 Y344C probably damaging Het
Vmn2r-ps117 A G 17: 18,824,647 D442G probably benign Het
Xpo6 A T 7: 126,140,389 probably null Het
Other mutations in Tmem5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Tmem5 APN 10 122094643 missense probably damaging 0.98
R0393:Tmem5 UTSW 10 122095936 splice site probably benign
R1130:Tmem5 UTSW 10 122095942 missense possibly damaging 0.46
R1521:Tmem5 UTSW 10 122090479 missense probably damaging 0.99
R1757:Tmem5 UTSW 10 122089015 missense probably benign
R3806:Tmem5 UTSW 10 122081609 missense possibly damaging 0.93
R6633:Tmem5 UTSW 10 122097053 missense probably damaging 0.98
R7237:Tmem5 UTSW 10 122081618 nonsense probably null
R7261:Tmem5 UTSW 10 122088917 missense probably benign 0.07
R7522:Tmem5 UTSW 10 122081439 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCCCTTTGTAACTGTGAG -3'
(R):5'- ACTGGTAAACGCAGTCACTC -3'

Sequencing Primer
(F):5'- CACAGTCTGTTTAGTGAGGACGACTC -3'
(R):5'- TCTCTTTAAAACAGAGCAGTCCG -3'
Posted On2019-10-24