Incidental Mutation 'R7631:Ifi203'
ID589616
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7631 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 173927122 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 681 (T681I)
Ref Sequence ENSEMBL: ENSMUSP00000122424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably damaging
Transcript: ENSMUST00000042228
AA Change: T267I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997
AA Change: T267I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081216
AA Change: T219I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997
AA Change: T219I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123708
AA Change: T219I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997
AA Change: T219I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129829
AA Change: T681I
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: T681I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156895
AA Change: T267I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997
AA Change: T267I

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 87% (46/53)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,579,672 L383S probably damaging Het
Agbl3 T A 6: 34,857,671 L930H possibly damaging Het
Alcam C T 16: 52,288,913 probably null Het
Ankrd31 A G 13: 96,878,954 H1577R probably benign Het
Arfgef1 T C 1: 10,232,469 N9S probably benign Het
Cpne9 T C 6: 113,302,118 V491A possibly damaging Het
Cyb5d1 A T 11: 69,395,039 L57Q possibly damaging Het
Cyp7a1 T A 4: 6,272,763 Q150L possibly damaging Het
D430041D05Rik A C 2: 104,149,018 Y1336* probably null Het
Dcaf7 T C 11: 106,053,753 V254A probably benign Het
Dchs1 T C 7: 105,759,238 T1796A probably benign Het
Defa27 T A 8: 21,315,641 D32E probably benign Het
Eno2 T C 6: 124,767,056 E96G probably benign Het
Fbxw19 T A 9: 109,482,001 Y380F probably damaging Het
Fer1l4 A T 2: 156,048,275 N243K probably damaging Het
Fndc7 G A 3: 108,869,252 A491V probably damaging Het
Gm14305 A G 2: 176,718,997 Q15R probably benign Het
Gpr155 T C 2: 73,382,947 probably benign Het
Grm5 A G 7: 87,975,305 H360R probably damaging Het
Klc2 A G 19: 5,108,619 S616P probably benign Het
Lifr A G 15: 7,184,777 Y704C probably damaging Het
Lingo4 A C 3: 94,399,460 D15A possibly damaging Het
Lrrc74a A T 12: 86,749,110 N286Y probably damaging Het
Mcm8 A G 2: 132,828,043 T374A not run Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa25 A G 5: 121,438,728 T847A possibly damaging Het
Nrxn2 T A 19: 6,481,795 M763K possibly damaging Het
Olfr1028 A T 2: 85,951,874 E270D probably benign Het
Olfr409-ps1 A C 11: 74,317,531 T169P unknown Het
Olfr457 T A 6: 42,471,936 M81L probably benign Het
Olfr891 A T 9: 38,180,706 V39E probably damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Otx1 G A 11: 21,999,458 Q7* probably null Het
Pabpc4 T G 4: 123,288,970 D133E probably damaging Het
Pcsk5 A T 19: 17,564,780 C816S probably damaging Het
Pgm1 A G 5: 64,108,179 T408A possibly damaging Het
Polr2m G C 9: 71,483,475 Y148* probably null Het
Reln T C 5: 21,971,935 N1911S probably damaging Het
Scaf4 T C 16: 90,229,557 D1124G unknown Het
Scgb1b19 C T 7: 33,287,359 T18I probably damaging Het
Sept12 T A 16: 4,996,456 I50F probably damaging Het
Slc25a20 T A 9: 108,662,292 M22K probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smchd1 A G 17: 71,398,689 F972L probably benign Het
Spem1 T C 11: 69,821,583 Y85C probably benign Het
Strip1 C T 3: 107,616,931 V557I possibly damaging Het
Tcirg1 G T 19: 3,897,160 Q634K probably damaging Het
Tma7 T A 9: 109,082,439 probably benign Het
Tmem204 A G 17: 25,080,440 L35P probably damaging Het
Trpc6 A G 9: 8,626,701 T351A probably benign Het
Tubb2a A G 13: 34,075,244 S188P probably damaging Het
Ubr5 C A 15: 38,029,507 L485F Het
Vmn1r71 A T 7: 10,748,451 S103R probably damaging Het
Vmn2r40 C T 7: 8,908,120 D725N Het
Zfp473 T C 7: 44,733,704 R402G possibly damaging Het
Zfp82 A T 7: 30,056,426 S410R probably damaging Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173933913 missense probably benign 0.33
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173928700 missense unknown
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATCGGACACACAGGAAGCTC -3'
(R):5'- CTACGTTGTAATATAGCAACCGTTG -3'

Sequencing Primer
(F):5'- CAGGAAGCTCTGTATATCTCCAG -3'
(R):5'- ATATGTTCTCCATTCTATTCAGTGGG -3'
Posted On2019-10-24