Incidental Mutation 'R7631:Fer1l4'
ID 589621
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 045692-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7631 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155890195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 243 (N243K)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109611
AA Change: N243K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: N243K

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 87% (46/53)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T A 6: 34,834,606 (GRCm39) L930H possibly damaging Het
Albfm1 T C 5: 90,727,531 (GRCm39) L383S probably damaging Het
Alcam C T 16: 52,109,276 (GRCm39) probably null Het
Ankrd31 A G 13: 97,015,462 (GRCm39) H1577R probably benign Het
Arfgef1 T C 1: 10,302,694 (GRCm39) N9S probably benign Het
Cpne9 T C 6: 113,279,079 (GRCm39) V491A possibly damaging Het
Cyb5d1 A T 11: 69,285,865 (GRCm39) L57Q possibly damaging Het
Cyp7a1 T A 4: 6,272,763 (GRCm39) Q150L possibly damaging Het
D430041D05Rik A C 2: 103,979,363 (GRCm39) Y1336* probably null Het
Dcaf7 T C 11: 105,944,579 (GRCm39) V254A probably benign Het
Dchs1 T C 7: 105,408,445 (GRCm39) T1796A probably benign Het
Defa27 T A 8: 21,805,657 (GRCm39) D32E probably benign Het
Eno2 T C 6: 124,744,019 (GRCm39) E96G probably benign Het
Fbxw19 T A 9: 109,311,069 (GRCm39) Y380F probably damaging Het
Fndc7 G A 3: 108,776,568 (GRCm39) A491V probably damaging Het
Gm14305 A G 2: 176,410,790 (GRCm39) Q15R probably benign Het
Gpr155 T C 2: 73,213,291 (GRCm39) probably benign Het
Grm5 A G 7: 87,624,513 (GRCm39) H360R probably damaging Het
Ifi203 G A 1: 173,754,688 (GRCm39) T681I unknown Het
Klc2 A G 19: 5,158,647 (GRCm39) S616P probably benign Het
Lifr A G 15: 7,214,258 (GRCm39) Y704C probably damaging Het
Lingo4 A C 3: 94,306,767 (GRCm39) D15A possibly damaging Het
Lrrc74a A T 12: 86,795,884 (GRCm39) N286Y probably damaging Het
Mcm8 A G 2: 132,669,963 (GRCm39) T374A not run Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naa25 A G 5: 121,576,791 (GRCm39) T847A possibly damaging Het
Nrxn2 T A 19: 6,531,825 (GRCm39) M763K possibly damaging Het
Onecut2 T A 18: 64,474,046 (GRCm39) M180K possibly damaging Het
Or1p4-ps1 A C 11: 74,208,357 (GRCm39) T169P unknown Het
Or2r3 T A 6: 42,448,870 (GRCm39) M81L probably benign Het
Or5m11 A T 2: 85,782,218 (GRCm39) E270D probably benign Het
Or8c13 A T 9: 38,092,002 (GRCm39) V39E probably damaging Het
Otx1 G A 11: 21,949,458 (GRCm39) Q7* probably null Het
Pabpc4 T G 4: 123,182,763 (GRCm39) D133E probably damaging Het
Pcsk5 A T 19: 17,542,144 (GRCm39) C816S probably damaging Het
Pgm2 A G 5: 64,265,522 (GRCm39) T408A possibly damaging Het
Polr2m G C 9: 71,390,757 (GRCm39) Y148* probably null Het
Reln T C 5: 22,176,933 (GRCm39) N1911S probably damaging Het
Scaf4 T C 16: 90,026,445 (GRCm39) D1124G unknown Het
Scgb1b19 C T 7: 32,986,784 (GRCm39) T18I probably damaging Het
Septin12 T A 16: 4,814,320 (GRCm39) I50F probably damaging Het
Slc25a20 T A 9: 108,539,491 (GRCm39) M22K probably benign Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smchd1 A G 17: 71,705,684 (GRCm39) F972L probably benign Het
Spem1 T C 11: 69,712,409 (GRCm39) Y85C probably benign Het
Strip1 C T 3: 107,524,247 (GRCm39) V557I possibly damaging Het
Tcirg1 G T 19: 3,947,160 (GRCm39) Q634K probably damaging Het
Tma7 T A 9: 108,911,507 (GRCm39) probably benign Het
Tmem204 A G 17: 25,299,414 (GRCm39) L35P probably damaging Het
Trpc6 A G 9: 8,626,702 (GRCm39) T351A probably benign Het
Tubb2a A G 13: 34,259,227 (GRCm39) S188P probably damaging Het
Ubr5 C A 15: 38,029,751 (GRCm39) L485F Het
Vmn1r71 A T 7: 10,482,378 (GRCm39) S103R probably damaging Het
Vmn2r40 C T 7: 8,911,119 (GRCm39) D725N Het
Zfp473 T C 7: 44,383,128 (GRCm39) R402G possibly damaging Het
Zfp82 A T 7: 29,755,851 (GRCm39) S410R probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TACTCTTTCCCCGGGATGAC -3'
(R):5'- TTGCAAAGCCCAGGACTTCC -3'

Sequencing Primer
(F):5'- GAACCAGCGACTTTGCATCCTG -3'
(R):5'- AGGACTTCCAGGTATGACTCTCAG -3'
Posted On 2019-10-24