Mutagenetix > Incidental Mutation

Incidental Mutation 'R7631:Agbl3'

589633

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

045692-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7631 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34857671 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 930 (L930H)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115016
AA Change: L930H

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: L930H

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: L925H

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: L925H

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

87% (46/53)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	T	C	5: 90,579,672	L383S	probably damaging	Het
Alcam	C	T	16: 52,288,913		probably null	Het
Ankrd31	A	G	13: 96,878,954	H1577R	probably benign	Het
Arfgef1	T	C	1: 10,232,469	N9S	probably benign	Het
Cpne9	T	C	6: 113,302,118	V491A	possibly damaging	Het
Cyb5d1	A	T	11: 69,395,039	L57Q	possibly damaging	Het
Cyp7a1	T	A	4: 6,272,763	Q150L	possibly damaging	Het
D430041D05Rik	A	C	2: 104,149,018	Y1336*	probably null	Het
Dcaf7	T	C	11: 106,053,753	V254A	probably benign	Het
Dchs1	T	C	7: 105,759,238	T1796A	probably benign	Het
Defa27	T	A	8: 21,315,641	D32E	probably benign	Het
Eno2	T	C	6: 124,767,056	E96G	probably benign	Het
Fbxw19	T	A	9: 109,482,001	Y380F	probably damaging	Het
Fer1l4	A	T	2: 156,048,275	N243K	probably damaging	Het
Fndc7	G	A	3: 108,869,252	A491V	probably damaging	Het
Gm14305	A	G	2: 176,718,997	Q15R	probably benign	Het
Gpr155	T	C	2: 73,382,947		probably benign	Het
Grm5	A	G	7: 87,975,305	H360R	probably damaging	Het
Ifi203	G	A	1: 173,927,122	T681I	unknown	Het
Klc2	A	G	19: 5,108,619	S616P	probably benign	Het
Lifr	A	G	15: 7,184,777	Y704C	probably damaging	Het
Lingo4	A	C	3: 94,399,460	D15A	possibly damaging	Het
Lrrc74a	A	T	12: 86,749,110	N286Y	probably damaging	Het
Mcm8	A	G	2: 132,828,043	T374A	not run	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naa25	A	G	5: 121,438,728	T847A	possibly damaging	Het
Nrxn2	T	A	19: 6,481,795	M763K	possibly damaging	Het
Olfr1028	A	T	2: 85,951,874	E270D	probably benign	Het
Olfr409-ps1	A	C	11: 74,317,531	T169P	unknown	Het
Olfr457	T	A	6: 42,471,936	M81L	probably benign	Het
Olfr891	A	T	9: 38,180,706	V39E	probably damaging	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Otx1	G	A	11: 21,999,458	Q7*	probably null	Het
Pabpc4	T	G	4: 123,288,970	D133E	probably damaging	Het
Pcsk5	A	T	19: 17,564,780	C816S	probably damaging	Het
Pgm1	A	G	5: 64,108,179	T408A	possibly damaging	Het
Polr2m	G	C	9: 71,483,475	Y148*	probably null	Het
Reln	T	C	5: 21,971,935	N1911S	probably damaging	Het
Scaf4	T	C	16: 90,229,557	D1124G	unknown	Het
Scgb1b19	C	T	7: 33,287,359	T18I	probably damaging	Het
Sept12	T	A	16: 4,996,456	I50F	probably damaging	Het
Slc25a20	T	A	9: 108,662,292	M22K	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Smchd1	A	G	17: 71,398,689	F972L	probably benign	Het
Spem1	T	C	11: 69,821,583	Y85C	probably benign	Het
Strip1	C	T	3: 107,616,931	V557I	possibly damaging	Het
Tcirg1	G	T	19: 3,897,160	Q634K	probably damaging	Het
Tma7	T	A	9: 109,082,439		probably benign	Het
Tmem204	A	G	17: 25,080,440	L35P	probably damaging	Het
Trpc6	A	G	9: 8,626,701	T351A	probably benign	Het
Tubb2a	A	G	13: 34,075,244	S188P	probably damaging	Het
Ubr5	C	A	15: 38,029,507	L485F		Het
Vmn1r71	A	T	7: 10,748,451	S103R	probably damaging	Het
Vmn2r40	C	T	7: 8,908,120	D725N		Het
Zfp473	T	C	7: 44,733,704	R402G	possibly damaging	Het
Zfp82	A	T	7: 30,056,426	S410R	probably damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCGAGGGAAACTTTACAGTC -3'
(R):5'- GCCCAGTTAACTGTTCCTGTG -3'

Sequencing Primer
(F):5'- GTCTGCATGATGACAGTATACCTAGG -3'
(R):5'- AAGGTGAGCAGGCCATCACTC -3'

Posted On

2019-10-24