Incidental Mutation 'R7631:Agbl3'
ID589633
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene NameATP/GTP binding protein-like 3
Synonyms4930431N21Rik, 2900053G10Rik, 6530406M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7631 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location34780432-34859459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34857671 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 930 (L930H)
Ref Sequence ENSEMBL: ENSMUSP00000110668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115016
AA Change: L930H

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: L930H

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115017
AA Change: L925H

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: L925H

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 87% (46/53)
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,579,672 L383S probably damaging Het
Alcam C T 16: 52,288,913 probably null Het
Ankrd31 A G 13: 96,878,954 H1577R probably benign Het
Arfgef1 T C 1: 10,232,469 N9S probably benign Het
Cpne9 T C 6: 113,302,118 V491A possibly damaging Het
Cyb5d1 A T 11: 69,395,039 L57Q possibly damaging Het
Cyp7a1 T A 4: 6,272,763 Q150L possibly damaging Het
D430041D05Rik A C 2: 104,149,018 Y1336* probably null Het
Dcaf7 T C 11: 106,053,753 V254A probably benign Het
Dchs1 T C 7: 105,759,238 T1796A probably benign Het
Defa27 T A 8: 21,315,641 D32E probably benign Het
Eno2 T C 6: 124,767,056 E96G probably benign Het
Fbxw19 T A 9: 109,482,001 Y380F probably damaging Het
Fer1l4 A T 2: 156,048,275 N243K probably damaging Het
Fndc7 G A 3: 108,869,252 A491V probably damaging Het
Gm14305 A G 2: 176,718,997 Q15R probably benign Het
Gpr155 T C 2: 73,382,947 probably benign Het
Grm5 A G 7: 87,975,305 H360R probably damaging Het
Ifi203 G A 1: 173,927,122 T681I unknown Het
Klc2 A G 19: 5,108,619 S616P probably benign Het
Lifr A G 15: 7,184,777 Y704C probably damaging Het
Lingo4 A C 3: 94,399,460 D15A possibly damaging Het
Lrrc74a A T 12: 86,749,110 N286Y probably damaging Het
Mcm8 A G 2: 132,828,043 T374A not run Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa25 A G 5: 121,438,728 T847A possibly damaging Het
Nrxn2 T A 19: 6,481,795 M763K possibly damaging Het
Olfr1028 A T 2: 85,951,874 E270D probably benign Het
Olfr409-ps1 A C 11: 74,317,531 T169P unknown Het
Olfr457 T A 6: 42,471,936 M81L probably benign Het
Olfr891 A T 9: 38,180,706 V39E probably damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Otx1 G A 11: 21,999,458 Q7* probably null Het
Pabpc4 T G 4: 123,288,970 D133E probably damaging Het
Pcsk5 A T 19: 17,564,780 C816S probably damaging Het
Pgm1 A G 5: 64,108,179 T408A possibly damaging Het
Polr2m G C 9: 71,483,475 Y148* probably null Het
Reln T C 5: 21,971,935 N1911S probably damaging Het
Scaf4 T C 16: 90,229,557 D1124G unknown Het
Scgb1b19 C T 7: 33,287,359 T18I probably damaging Het
Sept12 T A 16: 4,996,456 I50F probably damaging Het
Slc25a20 T A 9: 108,662,292 M22K probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smchd1 A G 17: 71,398,689 F972L probably benign Het
Spem1 T C 11: 69,821,583 Y85C probably benign Het
Strip1 C T 3: 107,616,931 V557I possibly damaging Het
Tcirg1 G T 19: 3,897,160 Q634K probably damaging Het
Tma7 T A 9: 109,082,439 probably benign Het
Tmem204 A G 17: 25,080,440 L35P probably damaging Het
Trpc6 A G 9: 8,626,701 T351A probably benign Het
Tubb2a A G 13: 34,075,244 S188P probably damaging Het
Ubr5 C A 15: 38,029,507 L485F Het
Vmn1r71 A T 7: 10,748,451 S103R probably damaging Het
Vmn2r40 C T 7: 8,908,120 D725N Het
Zfp473 T C 7: 44,733,704 R402G possibly damaging Het
Zfp82 A T 7: 30,056,426 S410R probably damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3237:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34785284 missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34803573 missense probably benign 0.21
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34846953 missense probably benign 0.03
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
R8033:Agbl3 UTSW 6 34839494 missense possibly damaging 0.95
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34799408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCGAGGGAAACTTTACAGTC -3'
(R):5'- GCCCAGTTAACTGTTCCTGTG -3'

Sequencing Primer
(F):5'- GTCTGCATGATGACAGTATACCTAGG -3'
(R):5'- AAGGTGAGCAGGCCATCACTC -3'
Posted On2019-10-24