Incidental Mutation 'R7631:Sltm'
ID589647
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7631 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 70586673 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 802 (P802R)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049263
AA Change: P802R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: P802R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: P784R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 87% (46/53)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,579,672 L383S probably damaging Het
Agbl3 T A 6: 34,857,671 L930H possibly damaging Het
Alcam C T 16: 52,288,913 probably null Het
Ankrd31 A G 13: 96,878,954 H1577R probably benign Het
Arfgef1 T C 1: 10,232,469 N9S probably benign Het
Cpne9 T C 6: 113,302,118 V491A possibly damaging Het
Cyb5d1 A T 11: 69,395,039 L57Q possibly damaging Het
Cyp7a1 T A 4: 6,272,763 Q150L possibly damaging Het
D430041D05Rik A C 2: 104,149,018 Y1336* probably null Het
Dcaf7 T C 11: 106,053,753 V254A probably benign Het
Dchs1 T C 7: 105,759,238 T1796A probably benign Het
Defa27 T A 8: 21,315,641 D32E probably benign Het
Eno2 T C 6: 124,767,056 E96G probably benign Het
Fbxw19 T A 9: 109,482,001 Y380F probably damaging Het
Fer1l4 A T 2: 156,048,275 N243K probably damaging Het
Fndc7 G A 3: 108,869,252 A491V probably damaging Het
Gm14305 A G 2: 176,718,997 Q15R probably benign Het
Gpr155 T C 2: 73,382,947 probably benign Het
Grm5 A G 7: 87,975,305 H360R probably damaging Het
Ifi203 G A 1: 173,927,122 T681I unknown Het
Klc2 A G 19: 5,108,619 S616P probably benign Het
Lifr A G 15: 7,184,777 Y704C probably damaging Het
Lingo4 A C 3: 94,399,460 D15A possibly damaging Het
Lrrc74a A T 12: 86,749,110 N286Y probably damaging Het
Mcm8 A G 2: 132,828,043 T374A not run Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa25 A G 5: 121,438,728 T847A possibly damaging Het
Nrxn2 T A 19: 6,481,795 M763K possibly damaging Het
Olfr1028 A T 2: 85,951,874 E270D probably benign Het
Olfr409-ps1 A C 11: 74,317,531 T169P unknown Het
Olfr457 T A 6: 42,471,936 M81L probably benign Het
Olfr891 A T 9: 38,180,706 V39E probably damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Otx1 G A 11: 21,999,458 Q7* probably null Het
Pabpc4 T G 4: 123,288,970 D133E probably damaging Het
Pcsk5 A T 19: 17,564,780 C816S probably damaging Het
Pgm1 A G 5: 64,108,179 T408A possibly damaging Het
Polr2m G C 9: 71,483,475 Y148* probably null Het
Reln T C 5: 21,971,935 N1911S probably damaging Het
Scaf4 T C 16: 90,229,557 D1124G unknown Het
Scgb1b19 C T 7: 33,287,359 T18I probably damaging Het
Sept12 T A 16: 4,996,456 I50F probably damaging Het
Slc25a20 T A 9: 108,662,292 M22K probably benign Het
Smchd1 A G 17: 71,398,689 F972L probably benign Het
Spem1 T C 11: 69,821,583 Y85C probably benign Het
Strip1 C T 3: 107,616,931 V557I possibly damaging Het
Tcirg1 G T 19: 3,897,160 Q634K probably damaging Het
Tma7 T A 9: 109,082,439 probably benign Het
Tmem204 A G 17: 25,080,440 L35P probably damaging Het
Trpc6 A G 9: 8,626,701 T351A probably benign Het
Tubb2a A G 13: 34,075,244 S188P probably damaging Het
Ubr5 C A 15: 38,029,507 L485F Het
Vmn1r71 A T 7: 10,748,451 S103R probably damaging Het
Vmn2r40 C T 7: 8,908,120 D725N Het
Zfp473 T C 7: 44,733,704 R402G possibly damaging Het
Zfp82 A T 7: 30,056,426 S410R probably damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AATGAGGGCTTTTCTGGCAGC -3'
(R):5'- TCCAGGAAGTTGGTCTAGAAGG -3'

Sequencing Primer
(F):5'- GCCTTGCCATAATTTCCCTTAAAAG -3'
(R):5'- CTAGAAGGATTGGGCACAGTCTCTC -3'
Posted On2019-10-24