Incidental Mutation 'R7631:Slc25a20'
ID589649
Institutional Source Beutler Lab
Gene Symbol Slc25a20
Ensembl Gene ENSMUSG00000032602
Gene Namesolute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20
Synonyms1110007P09Rik, Cact, mCAC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7631 (G1)
Quality Score190.009
Status Validated
Chromosome9
Chromosomal Location108662088-108684641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108662292 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 22 (M22K)
Ref Sequence ENSEMBL: ENSMUSP00000035222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035222]
Predicted Effect probably benign
Transcript: ENSMUST00000035222
AA Change: M22K

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000035222
Gene: ENSMUSG00000032602
AA Change: M22K

DomainStartEndE-ValueType
Pfam:Mito_carr 6 104 4.9e-25 PFAM
Pfam:Mito_carr 106 201 5.6e-27 PFAM
Pfam:Mito_carr 205 297 7.4e-23 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 87% (46/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is one of several closely related mitochondrial-membrane carrier proteins that shuttle substrates between cytosol and the intramitochondrial matrix space. This protein mediates the transport of acylcarnitines into mitochondrial matrix for their oxidation by the mitochondrial fatty acid-oxidation pathway. Mutations in this gene are associated with carnitine-acylcarnitine translocase deficiency, which can cause a variety of pathological conditions such as hypoglycemia, cardiac arrest, hepatomegaly, hepatic dysfunction and muscle weakness, and is usually lethal in new born and infants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,579,672 L383S probably damaging Het
Agbl3 T A 6: 34,857,671 L930H possibly damaging Het
Alcam C T 16: 52,288,913 probably null Het
Ankrd31 A G 13: 96,878,954 H1577R probably benign Het
Arfgef1 T C 1: 10,232,469 N9S probably benign Het
Cpne9 T C 6: 113,302,118 V491A possibly damaging Het
Cyb5d1 A T 11: 69,395,039 L57Q possibly damaging Het
Cyp7a1 T A 4: 6,272,763 Q150L possibly damaging Het
D430041D05Rik A C 2: 104,149,018 Y1336* probably null Het
Dcaf7 T C 11: 106,053,753 V254A probably benign Het
Dchs1 T C 7: 105,759,238 T1796A probably benign Het
Defa27 T A 8: 21,315,641 D32E probably benign Het
Eno2 T C 6: 124,767,056 E96G probably benign Het
Fbxw19 T A 9: 109,482,001 Y380F probably damaging Het
Fer1l4 A T 2: 156,048,275 N243K probably damaging Het
Fndc7 G A 3: 108,869,252 A491V probably damaging Het
Gm14305 A G 2: 176,718,997 Q15R probably benign Het
Gpr155 T C 2: 73,382,947 probably benign Het
Grm5 A G 7: 87,975,305 H360R probably damaging Het
Ifi203 G A 1: 173,927,122 T681I unknown Het
Klc2 A G 19: 5,108,619 S616P probably benign Het
Lifr A G 15: 7,184,777 Y704C probably damaging Het
Lingo4 A C 3: 94,399,460 D15A possibly damaging Het
Lrrc74a A T 12: 86,749,110 N286Y probably damaging Het
Mcm8 A G 2: 132,828,043 T374A not run Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa25 A G 5: 121,438,728 T847A possibly damaging Het
Nrxn2 T A 19: 6,481,795 M763K possibly damaging Het
Olfr1028 A T 2: 85,951,874 E270D probably benign Het
Olfr409-ps1 A C 11: 74,317,531 T169P unknown Het
Olfr457 T A 6: 42,471,936 M81L probably benign Het
Olfr891 A T 9: 38,180,706 V39E probably damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Otx1 G A 11: 21,999,458 Q7* probably null Het
Pabpc4 T G 4: 123,288,970 D133E probably damaging Het
Pcsk5 A T 19: 17,564,780 C816S probably damaging Het
Pgm1 A G 5: 64,108,179 T408A possibly damaging Het
Polr2m G C 9: 71,483,475 Y148* probably null Het
Reln T C 5: 21,971,935 N1911S probably damaging Het
Scaf4 T C 16: 90,229,557 D1124G unknown Het
Scgb1b19 C T 7: 33,287,359 T18I probably damaging Het
Sept12 T A 16: 4,996,456 I50F probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smchd1 A G 17: 71,398,689 F972L probably benign Het
Spem1 T C 11: 69,821,583 Y85C probably benign Het
Strip1 C T 3: 107,616,931 V557I possibly damaging Het
Tcirg1 G T 19: 3,897,160 Q634K probably damaging Het
Tma7 T A 9: 109,082,439 probably benign Het
Tmem204 A G 17: 25,080,440 L35P probably damaging Het
Trpc6 A G 9: 8,626,701 T351A probably benign Het
Tubb2a A G 13: 34,075,244 S188P probably damaging Het
Ubr5 C A 15: 38,029,507 L485F Het
Vmn1r71 A T 7: 10,748,451 S103R probably damaging Het
Vmn2r40 C T 7: 8,908,120 D725N Het
Zfp473 T C 7: 44,733,704 R402G possibly damaging Het
Zfp82 A T 7: 30,056,426 S410R probably damaging Het
Other mutations in Slc25a20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Slc25a20 APN 9 108681999 missense possibly damaging 0.86
IGL02496:Slc25a20 APN 9 108682400 missense probably damaging 1.00
R0882:Slc25a20 UTSW 9 108681990 missense possibly damaging 0.52
R1294:Slc25a20 UTSW 9 108677639 missense probably benign 0.14
R1881:Slc25a20 UTSW 9 108680209 splice site probably null
R4936:Slc25a20 UTSW 9 108681992 missense probably damaging 1.00
R7298:Slc25a20 UTSW 9 108662144 start gained probably benign
R7347:Slc25a20 UTSW 9 108682458 critical splice donor site probably null
R7400:Slc25a20 UTSW 9 108681973 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TAGTACGACTGGGCCCTCTTTC -3'
(R):5'- AAGCAGCGCTTCCTAGTAAAC -3'

Sequencing Primer
(F):5'- TTTCCGACCTGCCCACGG -3'
(R):5'- GGCATTCCTCCACAAGC -3'
Posted On2019-10-24