Mutagenetix > Incidental Mutation

Incidental Mutation 'R0055:Itpr2'

58966

Institutional Source

Beutler Lab

Gene Symbol

Itpr2

Ensembl Gene

ENSMUSG00000030287

Gene Name

inositol 1,4,5-triphosphate receptor 2

Synonyms

Itpr5, Ip3r2

MMRRC Submission

038349-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

146108299-146502223 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 146323133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1453 (N1453S)

Ref Sequence

ENSEMBL: ENSMUSP00000049584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053273
AA Change: N1453S

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: N1453S

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	173	223	8.9e-6	SMART
MIR	231	287	5.11e-6	SMART
MIR	294	402	3.73e-8	SMART
Pfam:RYDR_ITPR	473	670	1.5e-62	PFAM
low complexity region	882	890	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1346	1.6e-16	PFAM
low complexity region	1773	1785	N/A	INTRINSIC
low complexity region	1897	1908	N/A	INTRINSIC
Pfam:RIH_assoc	1912	2022	4.6e-34	PFAM
low complexity region	2088	2098	N/A	INTRINSIC
transmembrane domain	2228	2250	N/A	INTRINSIC
Pfam:Ion_trans	2260	2552	5.1e-20	PFAM
coiled coil region	2631	2686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079573
AA Change: N1420S

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: N1420S

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	198	254	5.11e-6	SMART
MIR	261	369	3.73e-8	SMART
Pfam:RYDR_ITPR	438	644	5.4e-75	PFAM
low complexity region	849	857	N/A	INTRINSIC
Pfam:RYDR_ITPR	1148	1322	7.2e-60	PFAM
low complexity region	1740	1752	N/A	INTRINSIC
Pfam:RIH_assoc	1875	1994	5.8e-35	PFAM
low complexity region	2055	2065	N/A	INTRINSIC
transmembrane domain	2195	2217	N/A	INTRINSIC
transmembrane domain	2230	2249	N/A	INTRINSIC
low complexity region	2268	2279	N/A	INTRINSIC
Pfam:Ion_trans	2281	2507	2.4e-12	PFAM
coiled coil region	2598	2653	N/A	INTRINSIC

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,968,161	S108R	probably damaging	Het
2010300C02Rik	A	C	1: 37,624,256	S854A	probably benign	Het
2210016F16Rik	T	C	13: 58,384,166	D192G	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,722	W369R	probably damaging	Het
A2ml1	T	C	6: 128,570,094		probably benign	Het
Atp6v1h	A	T	1: 5,084,454	T2S	probably benign	Het
Bcl11b	G	A	12: 107,965,777	P179S	probably benign	Het
Cacna1a	C	T	8: 84,580,058		probably benign	Het
Ccdc146	C	T	5: 21,297,006		probably null	Het
Ccdc61	T	C	7: 18,892,536	D128G	probably damaging	Het
Cd55	A	G	1: 130,459,576		probably benign	Het
Cdk7	C	A	13: 100,719,304	E99*	probably null	Het
Cox8a	A	T	19: 7,217,509	S2T	probably damaging	Het
Dennd5a	A	G	7: 109,899,791	I955T	possibly damaging	Het
Dopey1	A	C	9: 86,512,652	E602A	probably benign	Het
Ephx4	T	C	5: 107,413,078	L32S	probably damaging	Het
Fbxo21	T	A	5: 118,000,490	D493E	probably benign	Het
Frmd4b	A	T	6: 97,323,649		probably benign	Het
Fzd1	A	T	5: 4,756,037	M515K	possibly damaging	Het
Gli2	A	G	1: 118,890,408		probably benign	Het
Gm12887	T	A	4: 121,616,469	K61N	probably damaging	Het
Grin2a	A	T	16: 9,669,807	V409D	probably damaging	Het
Grin2b	T	C	6: 135,923,203	I227V	probably benign	Het
Helz2	T	G	2: 181,228,821	D2879A	possibly damaging	Het
Itpr3	C	A	17: 27,098,322	S817Y	probably damaging	Het
Lin7c	T	A	2: 109,896,453		probably benign	Het
Ly75	T	C	2: 60,321,918	E1097G	probably benign	Het
Mcm10	T	C	2: 4,991,407	N882D	probably damaging	Het
Mettl13	A	T	1: 162,546,181	L167Q	probably damaging	Het
Morn2	A	T	17: 80,295,513	M1L	probably benign	Het
Mybph	G	T	1: 134,193,852	V88L	probably damaging	Het
Nefm	T	A	14: 68,121,199		probably benign	Het
Nf1	A	G	11: 79,471,551	E1497G	probably damaging	Het
Olfr1281	T	A	2: 111,328,525	Y35*	probably null	Het
Olfr137	T	C	17: 38,304,811	S217G	possibly damaging	Het
Olfr615	A	G	7: 103,561,037	K187E	probably damaging	Het
Olfr670	T	A	7: 104,960,496	T79S	possibly damaging	Het
Plcd3	C	G	11: 103,077,585	W382S	probably damaging	Het
Plxna1	T	A	6: 89,329,739	I1370F	possibly damaging	Het
Rarb	G	A	14: 16,509,066	R106C	probably damaging	Het
Rps6ka5	G	A	12: 100,678,580	T37I	probably damaging	Het
Runx1	G	T	16: 92,644,141		probably benign	Het
Scube1	A	G	15: 83,634,736	V301A	probably damaging	Het
Sema3a	A	T	5: 13,400,037	N27I	possibly damaging	Het
Slc15a3	G	T	19: 10,843,042	E8*	probably null	Het
Slc22a5	T	C	11: 53,891,206	S112G	probably benign	Het
Slc25a45	T	C	19: 5,880,467	F3L	probably damaging	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slfn10-ps	A	G	11: 83,030,300		noncoding transcript	Het
Slit2	C	A	5: 48,281,726	C1077*	probably null	Het
Spn	A	G	7: 127,136,322	F82L	possibly damaging	Het
Tbccd1	A	G	16: 22,841,905	W54R	probably damaging	Het
Ucp1	G	T	8: 83,290,604	E8*	probably null	Het
Unc80	A	T	1: 66,506,623		probably benign	Het
Vsnl1	A	T	12: 11,386,986		probably null	Het
Zdhhc11	C	T	13: 73,982,686	Q295*	probably null	Het
Zfp457	T	A	13: 67,294,034	H63L	probably damaging	Het

Other mutations in Itpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Itpr2	APN	6	146397012	missense	probably damaging	0.99
IGL00163:Itpr2	APN	6	146390836	missense	possibly damaging	0.88
IGL00229:Itpr2	APN	6	146144185	missense	probably damaging	1.00
IGL00712:Itpr2	APN	6	146232436	missense	possibly damaging	0.63
IGL00952:Itpr2	APN	6	146158961	missense	probably damaging	1.00
IGL00983:Itpr2	APN	6	146310981	splice site	probably benign
IGL01012:Itpr2	APN	6	146345161	missense	probably damaging	1.00
IGL01289:Itpr2	APN	6	146112535	nonsense	probably null
IGL01411:Itpr2	APN	6	146376062	critical splice donor site	probably null
IGL01557:Itpr2	APN	6	146158976	missense	probably damaging	0.99
IGL01669:Itpr2	APN	6	146180229	missense	probably damaging	1.00
IGL01809:Itpr2	APN	6	146227581	missense	probably damaging	1.00
IGL01814:Itpr2	APN	6	146232546	missense	probably benign	0.02
IGL02198:Itpr2	APN	6	146323227	missense	probably damaging	1.00
IGL02218:Itpr2	APN	6	146240262	splice site	probably benign
IGL02332:Itpr2	APN	6	146426542	missense	probably damaging	1.00
IGL02425:Itpr2	APN	6	146391321	missense	probably damaging	0.99
IGL02432:Itpr2	APN	6	146325173	missense	probably benign	0.05
IGL02726:Itpr2	APN	6	146375921	missense	probably benign	0.18
IGL02851:Itpr2	APN	6	146385979	missense	probably damaging	0.99
IGL02933:Itpr2	APN	6	146312904	missense	probably benign
IGL03015:Itpr2	APN	6	146375937	missense	probably benign
IGL03067:Itpr2	APN	6	146325182	missense	probably damaging	1.00
IGL03093:Itpr2	APN	6	146379510	missense	probably damaging	1.00
IGL03214:Itpr2	APN	6	146180244	missense	probably benign	0.02
IGL03275:Itpr2	APN	6	146158877	splice site	probably benign
IGL03332:Itpr2	APN	6	146144149	missense	probably damaging	0.98
IGL03352:Itpr2	APN	6	146157104	missense	probably damaging	1.00
IGL03377:Itpr2	APN	6	146329715	missense	probably damaging	0.96
IGL03377:Itpr2	APN	6	146329758	missense	probably benign
dollar_short	UTSW	6	146397019	nonsense	probably null
enfermos	UTSW	6	146234006	missense	probably damaging	0.98
Hopla	UTSW	6	146194598	missense	probably damaging	0.98
P0029:Itpr2	UTSW	6	146379489	missense	probably damaging	1.00
PIT4431001:Itpr2	UTSW	6	146354720	missense	probably benign
PIT4453001:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
PIT4504001:Itpr2	UTSW	6	146229871	missense	probably damaging	0.99
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0088:Itpr2	UTSW	6	146241185	missense	probably benign
R0089:Itpr2	UTSW	6	146350022	critical splice donor site	probably null
R0114:Itpr2	UTSW	6	146312879	missense	probably damaging	1.00
R0125:Itpr2	UTSW	6	146240453	missense	probably benign	0.00
R0144:Itpr2	UTSW	6	146327155	missense	probably damaging	0.98
R0180:Itpr2	UTSW	6	146501909	start gained	probably benign
R0211:Itpr2	UTSW	6	146194613	missense	probably benign	0.17
R0305:Itpr2	UTSW	6	146311103	missense	possibly damaging	0.63
R0367:Itpr2	UTSW	6	146234008	missense	probably damaging	1.00
R0374:Itpr2	UTSW	6	146359392	missense	probably benign	0.00
R0391:Itpr2	UTSW	6	146229773	missense	probably damaging	1.00
R0450:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0464:Itpr2	UTSW	6	146375889	missense	probably damaging	1.00
R0510:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0532:Itpr2	UTSW	6	146112400	missense	probably damaging	1.00
R0625:Itpr2	UTSW	6	146166651	missense	probably benign
R0633:Itpr2	UTSW	6	146374456	missense	probably damaging	1.00
R0636:Itpr2	UTSW	6	146171412	missense	probably damaging	1.00
R1086:Itpr2	UTSW	6	146350045	missense	probably damaging	1.00
R1352:Itpr2	UTSW	6	146111742	missense	probably damaging	1.00
R1631:Itpr2	UTSW	6	146180290	missense	probably damaging	1.00
R1655:Itpr2	UTSW	6	146376148	missense	probably damaging	1.00
R1767:Itpr2	UTSW	6	146350068	missense	possibly damaging	0.91
R1779:Itpr2	UTSW	6	146158901	nonsense	probably null
R1796:Itpr2	UTSW	6	146296673	missense	probably benign
R1815:Itpr2	UTSW	6	146359416	missense	probably benign	0.08
R1827:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1828:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1884:Itpr2	UTSW	6	146385971	missense	probably benign	0.16
R1902:Itpr2	UTSW	6	146229703	missense	probably damaging	1.00
R1931:Itpr2	UTSW	6	146240354	missense	probably benign	0.41
R1964:Itpr2	UTSW	6	146111693	missense	probably damaging	1.00
R2010:Itpr2	UTSW	6	146227524	splice site	probably null
R2168:Itpr2	UTSW	6	146111678	missense	probably benign	0.05
R2179:Itpr2	UTSW	6	146375966	missense	probably benign
R2290:Itpr2	UTSW	6	146422828	missense	probably damaging	1.00
R2874:Itpr2	UTSW	6	146426498	missense	possibly damaging	0.73
R2888:Itpr2	UTSW	6	146171293	missense	probably damaging	1.00
R2897:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2897:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R2898:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2898:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R3024:Itpr2	UTSW	6	146180310	missense	probably benign	0.35
R3104:Itpr2	UTSW	6	146312837	critical splice donor site	probably null
R3607:Itpr2	UTSW	6	146227601	missense	probably damaging	0.98
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3733:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3792:Itpr2	UTSW	6	146415354	missense	probably damaging	1.00
R3806:Itpr2	UTSW	6	146232291	splice site	probably null
R3821:Itpr2	UTSW	6	146417726	missense	probably damaging	1.00
R3929:Itpr2	UTSW	6	146374359	splice site	probably null
R3958:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3959:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3960:Itpr2	UTSW	6	146229764	missense	probably damaging	1.00
R3960:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4074:Itpr2	UTSW	6	146373244	splice site	probably null
R4085:Itpr2	UTSW	6	146144248	missense	probably damaging	1.00
R4114:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4115:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4588:Itpr2	UTSW	6	146241196	missense	probably benign	0.33
R4663:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4673:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4684:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4686:Itpr2	UTSW	6	146229775	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146396958	missense	probably damaging	1.00
R4729:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4732:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4733:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4801:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4802:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4877:Itpr2	UTSW	6	146325205	missense	probably damaging	1.00
R4970:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R4986:Itpr2	UTSW	6	146240342	missense	probably damaging	0.96
R5112:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R5200:Itpr2	UTSW	6	146144107	critical splice donor site	probably null
R5224:Itpr2	UTSW	6	146166651	missense	probably benign
R5243:Itpr2	UTSW	6	146187546	missense	probably damaging	1.00
R5348:Itpr2	UTSW	6	146476693	missense	possibly damaging	0.78
R5393:Itpr2	UTSW	6	146376155	nonsense	probably null
R5552:Itpr2	UTSW	6	146294080	missense	probably benign
R5579:Itpr2	UTSW	6	146173366	nonsense	probably null
R5744:Itpr2	UTSW	6	146376151	missense	probably damaging	1.00
R5825:Itpr2	UTSW	6	146144149	missense	probably damaging	0.98
R5910:Itpr2	UTSW	6	146329571	missense	probably benign	0.10
R5911:Itpr2	UTSW	6	146312943	missense	probably benign	0.42
R6044:Itpr2	UTSW	6	146396951	missense	probably null	0.98
R6072:Itpr2	UTSW	6	146347111	missense	probably damaging	0.98
R6191:Itpr2	UTSW	6	146328335	missense	probably benign	0.01
R6483:Itpr2	UTSW	6	146112477	missense	possibly damaging	0.52
R6511:Itpr2	UTSW	6	146329727	missense	probably damaging	1.00
R6524:Itpr2	UTSW	6	146345211	missense	probably benign	0.01
R6561:Itpr2	UTSW	6	146234006	missense	probably damaging	0.98
R6594:Itpr2	UTSW	6	146190480	missense	possibly damaging	0.71
R6603:Itpr2	UTSW	6	146347171	missense	probably damaging	0.98
R6736:Itpr2	UTSW	6	146325170	missense	probably damaging	1.00
R6783:Itpr2	UTSW	6	146385873	critical splice donor site	probably null
R6831:Itpr2	UTSW	6	146112429	missense	probably damaging	1.00
R6857:Itpr2	UTSW	6	146397019	nonsense	probably null
R7103:Itpr2	UTSW	6	146325074	missense	probably damaging	1.00
R7111:Itpr2	UTSW	6	146325056	missense	probably damaging	1.00
R7126:Itpr2	UTSW	6	146357796	nonsense	probably null
R7165:Itpr2	UTSW	6	146294091	missense	probably damaging	1.00
R7184:Itpr2	UTSW	6	146311087	missense	possibly damaging	0.79
R7249:Itpr2	UTSW	6	146311052	missense	probably damaging	1.00
R7292:Itpr2	UTSW	6	146158949	missense	possibly damaging	0.95
R7342:Itpr2	UTSW	6	146327187	missense	probably damaging	0.98
R7392:Itpr2	UTSW	6	146359340	missense	possibly damaging	0.95
R7414:Itpr2	UTSW	6	146373208	missense	probably benign	0.06
R7448:Itpr2	UTSW	6	146329508	missense	probably damaging	1.00
R7492:Itpr2	UTSW	6	146390938	missense	probably damaging	1.00
R7515:Itpr2	UTSW	6	146327110	missense	probably damaging	1.00
R7529:Itpr2	UTSW	6	146194598	missense	probably damaging	0.98
R7558:Itpr2	UTSW	6	146390865	missense	probably damaging	1.00
R7650:Itpr2	UTSW	6	146233994	missense	probably benign	0.36
R7678:Itpr2	UTSW	6	146187550	missense	probably benign	0.00
R7790:Itpr2	UTSW	6	146224776	missense	probably damaging	1.00
R7798:Itpr2	UTSW	6	146386015	missense	probably benign	0.06
R7831:Itpr2	UTSW	6	146291584	missense	probably benign	0.04
R8023:Itpr2	UTSW	6	146187490	missense	probably damaging	0.97
R8046:Itpr2	UTSW	6	146426459	missense	probably damaging	0.96
R8236:Itpr2	UTSW	6	146390783	critical splice donor site	probably null
R8241:Itpr2	UTSW	6	146418515	missense	possibly damaging	0.90
R8245:Itpr2	UTSW	6	146373106	missense	probably damaging	0.98
R8324:Itpr2	UTSW	6	146328398	missense	probably damaging	0.97
R8339:Itpr2	UTSW	6	146312898	missense	probably benign	0.19
R8458:Itpr2	UTSW	6	146233966	missense	possibly damaging	0.62
R8506:Itpr2	UTSW	6	146418416	critical splice donor site	probably null
R8529:Itpr2	UTSW	6	146329553	missense	probably damaging	1.00
R8672:Itpr2	UTSW	6	146374518	missense	probably damaging	1.00
R8755:Itpr2	UTSW	6	146232428	missense	probably benign
R8816:Itpr2	UTSW	6	146241212	missense	probably damaging	0.98
R9160:Itpr2	UTSW	6	146374601	missense	probably damaging	1.00
R9273:Itpr2	UTSW	6	146325031	missense	probably damaging	1.00
R9284:Itpr2	UTSW	6	146354676	missense	probably benign	0.01
R9322:Itpr2	UTSW	6	146325089	missense	probably benign	0.19
R9357:Itpr2	UTSW	6	146359316	missense	probably damaging	1.00
R9424:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
R9438:Itpr2	UTSW	6	146166668	missense	probably benign
R9576:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
V8831:Itpr2	UTSW	6	146385882	missense	probably damaging	1.00
X0054:Itpr2	UTSW	6	146323236	missense	probably damaging	1.00
X0063:Itpr2	UTSW	6	146180353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTAAGCTCAGTCACCAGCCCAG -3'
(R):5'- ATGGAATGCTAGAACACAGGCTCG -3'

Sequencing Primer
(F):5'- AAGGTTCCCACAGGTCACTG -3'
(R):5'- TGTCATCCATGACAGGAGCTG -3'

Posted On

2013-07-11