Incidental Mutation 'R7631:Klc2'
ID589668
Institutional Source Beutler Lab
Gene Symbol Klc2
Ensembl Gene ENSMUSG00000024862
Gene Namekinesin light chain 2
Synonyms8030455F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R7631 (G1)
Quality Score166.009
Status Not validated
Chromosome19
Chromosomal Location5107746-5118560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5108619 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 616 (S616P)
Ref Sequence ENSEMBL: ENSMUSP00000112262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025798] [ENSMUST00000025804] [ENSMUST00000113727] [ENSMUST00000113728] [ENSMUST00000116563]
PDB Structure
Crystal structure of the TPR domain of kinesin light chain 2 in complex with a tryptophan-acidic cargo peptide [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000025798
AA Change: S614P
SMART Domains Protein: ENSMUSP00000025798
Gene: ENSMUSG00000024862
AA Change: S614P

DomainStartEndE-ValueType
Pfam:Rab5-bind 69 239 4.1e-64 PFAM
Pfam:TPR_10 197 238 9.5e-9 PFAM
TPR 240 273 6.19e-1 SMART
TPR 282 315 1.16e-5 SMART
TPR 324 357 2.16e0 SMART
TPR 366 399 1.6e-3 SMART
Pfam:TPR_10 448 483 1.5e-4 PFAM
low complexity region 496 507 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 592 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025804
SMART Domains Protein: ENSMUSP00000025804
Gene: ENSMUSG00000024870

DomainStartEndE-ValueType
RAB 9 172 4.57e-105 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113727
AA Change: S614P
SMART Domains Protein: ENSMUSP00000109356
Gene: ENSMUSG00000024862
AA Change: S614P

DomainStartEndE-ValueType
Pfam:Rab5-bind 69 239 4.1e-64 PFAM
Pfam:TPR_10 197 238 9.5e-9 PFAM
TPR 240 273 6.19e-1 SMART
TPR 282 315 1.16e-5 SMART
TPR 324 357 2.16e0 SMART
TPR 366 399 1.6e-3 SMART
Pfam:TPR_10 448 483 1.5e-4 PFAM
low complexity region 496 507 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 592 615 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113728
AA Change: S614P
SMART Domains Protein: ENSMUSP00000109357
Gene: ENSMUSG00000024862
AA Change: S614P

DomainStartEndE-ValueType
Pfam:Rab5-bind 69 239 4.1e-64 PFAM
Pfam:TPR_10 197 238 9.5e-9 PFAM
TPR 240 273 6.19e-1 SMART
TPR 282 315 1.16e-5 SMART
TPR 324 357 2.16e0 SMART
TPR 366 399 1.6e-3 SMART
Pfam:TPR_10 448 483 1.5e-4 PFAM
low complexity region 496 507 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 592 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116563
AA Change: S616P

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112262
Gene: ENSMUSG00000024862
AA Change: S616P

DomainStartEndE-ValueType
coiled coil region 80 140 N/A INTRINSIC
Pfam:TPR_10 197 238 3.1e-9 PFAM
TPR 240 273 6.19e-1 SMART
TPR 282 315 1.16e-5 SMART
TPR 324 357 2.16e0 SMART
TPR 366 399 1.6e-3 SMART
low complexity region 416 428 N/A INTRINSIC
Pfam:TPR_10 450 486 1.1e-4 PFAM
low complexity region 498 509 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a light chain of kinesin, a molecular motor responsible for moving vesicles and organelles along microtubules. Defects in this gene are a cause of spastic paraplegia, optic atrophy, and neuropathy (SPOAN) syndrome. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,579,672 L383S probably damaging Het
Agbl3 T A 6: 34,857,671 L930H possibly damaging Het
Ankrd31 A G 13: 96,878,954 H1577R probably benign Het
Arfgef1 T C 1: 10,232,469 N9S probably benign Het
Cpne9 T C 6: 113,302,118 V491A possibly damaging Het
Cyb5d1 A T 11: 69,395,039 L57Q possibly damaging Het
Cyp7a1 T A 4: 6,272,763 Q150L possibly damaging Het
D430041D05Rik A C 2: 104,149,018 Y1336* probably null Het
Dcaf7 T C 11: 106,053,753 V254A probably benign Het
Dchs1 T C 7: 105,759,238 T1796A probably benign Het
Defa27 T A 8: 21,315,641 D32E probably benign Het
Eno2 T C 6: 124,767,056 E96G probably benign Het
Fbxw19 T A 9: 109,482,001 Y380F probably damaging Het
Fer1l4 A T 2: 156,048,275 N243K probably damaging Het
Fndc7 G A 3: 108,869,252 A491V probably damaging Het
Gm14305 A G 2: 176,718,997 Q15R probably benign Het
Gpr155 T C 2: 73,382,947 probably benign Het
Grm5 A G 7: 87,975,305 H360R probably damaging Het
Ifi203 G A 1: 173,927,122 T681I unknown Het
Lifr A G 15: 7,184,777 Y704C probably damaging Het
Lingo4 A C 3: 94,399,460 D15A possibly damaging Het
Lrrc74a A T 12: 86,749,110 N286Y probably damaging Het
Mcm8 A G 2: 132,828,043 T374A not run Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa25 A G 5: 121,438,728 T847A possibly damaging Het
Nrxn2 T A 19: 6,481,795 M763K possibly damaging Het
Olfr1028 A T 2: 85,951,874 E270D probably benign Het
Olfr409-ps1 A C 11: 74,317,531 T169P unknown Het
Olfr457 T A 6: 42,471,936 M81L probably benign Het
Olfr891 A T 9: 38,180,706 V39E probably damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Otx1 G A 11: 21,999,458 Q7* probably null Het
Pabpc4 T G 4: 123,288,970 D133E probably damaging Het
Pcsk5 A T 19: 17,564,780 C816S probably damaging Het
Pgm1 A G 5: 64,108,179 T408A possibly damaging Het
Polr2m G C 9: 71,483,475 Y148* probably null Het
Reln T C 5: 21,971,935 N1911S probably damaging Het
Scaf4 T C 16: 90,229,557 D1124G unknown Het
Scgb1b19 C T 7: 33,287,359 T18I probably damaging Het
Sept12 T A 16: 4,996,456 I50F probably damaging Het
Slc25a20 T A 9: 108,662,292 M22K probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smchd1 A G 17: 71,398,689 F972L probably benign Het
Spem1 T C 11: 69,821,583 Y85C probably benign Het
Strip1 C T 3: 107,616,931 V557I possibly damaging Het
Tcirg1 G T 19: 3,897,160 Q634K probably damaging Het
Tma7 T A 9: 109,082,439 probably benign Het
Tmem204 A G 17: 25,080,440 L35P probably damaging Het
Trpc6 A G 9: 8,626,701 T351A probably benign Het
Tubb2a A G 13: 34,075,244 S188P probably damaging Het
Ubr5 C A 15: 38,029,507 L485F Het
Vmn1r71 A T 7: 10,748,451 S103R probably damaging Het
Vmn2r40 C T 7: 8,908,120 D725N Het
Zfp473 T C 7: 44,733,704 R402G possibly damaging Het
Zfp82 A T 7: 30,056,426 S410R probably damaging Het
Other mutations in Klc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Klc2 APN 19 5111662 missense probably benign 0.17
IGL00822:Klc2 APN 19 5111513 missense probably damaging 1.00
IGL01732:Klc2 APN 19 5109797 missense probably damaging 1.00
IGL02374:Klc2 APN 19 5110410 missense possibly damaging 0.76
IGL02677:Klc2 APN 19 5111668 missense probably damaging 1.00
P0042:Klc2 UTSW 19 5113777 unclassified probably benign
R0126:Klc2 UTSW 19 5112746 missense possibly damaging 0.93
R1687:Klc2 UTSW 19 5111654 missense probably damaging 1.00
R1887:Klc2 UTSW 19 5108612 missense probably benign 0.00
R5620:Klc2 UTSW 19 5112856 missense probably damaging 1.00
R6977:Klc2 UTSW 19 5109365 missense probably damaging 1.00
R7622:Klc2 UTSW 19 5111632 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCATGGCTGAGATGACAAGG -3'
(R):5'- AGGTCCTGGTTGTGAGCTAAAC -3'

Sequencing Primer
(F):5'- GGAGGAAGTTACCCTGAGATTG -3'
(R):5'- GTCCTGGTTGTGAGCTAAACTTTAAC -3'
Posted On2019-10-24