Incidental Mutation 'R7632:Tecpr1'
ID 589684
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms 2210010N04Rik
MMRRC Submission 045720-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7632 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 144131260-144160433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 144155544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 5 (V5M)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect probably benign
Transcript: ENSMUST00000085701
AA Change: V5M

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: V5M

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,211,236 (GRCm39) D924G probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atrnl1 A G 19: 57,618,738 (GRCm39) D152G probably damaging Het
B3gnt8 A G 7: 25,327,860 (GRCm39) I97V possibly damaging Het
Bach1 A G 16: 87,517,031 (GRCm39) D524G probably benign Het
Caprin2 T C 6: 148,784,954 (GRCm39) S107G probably damaging Het
Ccnb1 A G 13: 100,918,209 (GRCm39) I207T probably benign Het
Cdh11 T C 8: 103,400,515 (GRCm39) D151G probably damaging Het
Cdh9 A G 15: 16,851,115 (GRCm39) probably null Het
Cep83 A T 10: 94,586,502 (GRCm39) R433W probably damaging Het
Cspg4b C A 13: 113,457,420 (GRCm39) S1155R Het
D3Ertd751e A G 3: 41,708,163 (GRCm39) E100G probably benign Het
Dchs2 C T 3: 83,255,357 (GRCm39) A2351V probably benign Het
Dhx40 T C 11: 86,690,263 (GRCm39) T253A probably benign Het
Dqx1 A G 6: 83,036,680 (GRCm39) D228G probably benign Het
Dync1h1 T C 12: 110,627,327 (GRCm39) M4002T probably benign Het
Flcn C T 11: 59,686,625 (GRCm39) W376* probably null Het
Flnc A T 6: 29,446,984 (GRCm39) Y1037F probably damaging Het
Fut11 T A 14: 20,745,096 (GRCm39) V9E probably benign Het
Fv1 T A 4: 147,954,392 (GRCm39) N319K possibly damaging Het
Ghrhr G T 6: 55,361,727 (GRCm39) G298V probably benign Het
Gm5800 T A 14: 51,953,905 (GRCm39) probably null Het
Grin2b A G 6: 135,709,553 (GRCm39) M1331T probably benign Het
Hyou1 A G 9: 44,292,433 (GRCm39) probably null Het
Igkv1-117 C A 6: 68,098,792 (GRCm39) Q114K probably damaging Het
Igkv4-68 A G 6: 69,282,048 (GRCm39) V41A possibly damaging Het
Inpp4b A G 8: 82,772,968 (GRCm39) N754S probably damaging Het
Isl2 G A 9: 55,448,440 (GRCm39) probably null Het
Kat2a G A 11: 100,599,422 (GRCm39) Q523* probably null Het
Lypd3 T C 7: 24,337,865 (GRCm39) F77S possibly damaging Het
Map4k2 T C 19: 6,394,084 (GRCm39) L297P probably benign Het
Naca T C 10: 127,876,375 (GRCm39) V469A unknown Het
Notch3 C T 17: 32,377,480 (GRCm39) V199I probably benign Het
Or4k44 T C 2: 111,368,521 (GRCm39) I38V possibly damaging Het
Or5b119 T C 19: 13,456,795 (GRCm39) M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,598,212 (GRCm39) probably null Het
Pcdhb8 A T 18: 37,488,648 (GRCm39) I109L probably benign Het
Pde2a A G 7: 101,133,801 (GRCm39) D104G possibly damaging Het
Phip A G 9: 82,785,243 (GRCm39) V824A probably benign Het
Plekhg4 T C 8: 106,106,782 (GRCm39) Y853H probably damaging Het
Plod1 T C 4: 148,011,481 (GRCm39) K248R probably damaging Het
Plxnd1 A T 6: 115,953,600 (GRCm39) Y656N probably benign Het
Pogz G A 3: 94,763,517 (GRCm39) probably null Het
Ppp1r3e T A 14: 55,114,526 (GRCm39) S79C probably damaging Het
Pprc1 T A 19: 46,060,721 (GRCm39) D1595E probably damaging Het
Ptprq A G 10: 107,547,783 (GRCm39) V205A probably benign Het
Rad51ap2 T C 12: 11,507,116 (GRCm39) V346A possibly damaging Het
Rgs12 T A 5: 35,122,934 (GRCm39) L239H probably damaging Het
Rrp8 T C 7: 105,385,727 (GRCm39) probably benign Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Scaf1 A T 7: 44,656,503 (GRCm39) V792D unknown Het
Scrn2 G T 11: 96,923,968 (GRCm39) R284L possibly damaging Het
Sgsm1 T A 5: 113,423,948 (GRCm39) Q461L possibly damaging Het
Slc18b1 A G 10: 23,702,080 (GRCm39) T434A probably benign Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Snx33 A T 9: 56,833,702 (GRCm39) D122E probably damaging Het
Srebf2 G T 15: 82,069,497 (GRCm39) V680L probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Tfg A G 16: 56,532,997 (GRCm39) V54A possibly damaging Het
Tmem237 C T 1: 59,156,060 (GRCm39) C30Y probably benign Het
Tmem245 T C 4: 56,916,787 (GRCm39) K444R probably benign Het
Trim25 T G 11: 88,906,602 (GRCm39) L446R probably null Het
Usp37 T C 1: 74,507,533 (GRCm39) T495A probably benign Het
Vmn1r94 T G 7: 19,901,696 (GRCm39) T203P probably damaging Het
Ywhah T A 5: 33,184,010 (GRCm39) M71K probably benign Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144,145,411 (GRCm39) critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144,148,358 (GRCm39) missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144,153,737 (GRCm39) missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144,134,806 (GRCm39) splice site probably benign
IGL02244:Tecpr1 APN 5 144,146,821 (GRCm39) missense probably benign
IGL02247:Tecpr1 APN 5 144,143,372 (GRCm39) missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144,140,305 (GRCm39) missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144,143,364 (GRCm39) missense probably benign 0.28
larghissimo UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144,150,885 (GRCm39) missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144,147,017 (GRCm39) missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144,134,717 (GRCm39) missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144,155,335 (GRCm39) missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144,144,294 (GRCm39) missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144,132,759 (GRCm39) missense probably benign
R0504:Tecpr1 UTSW 5 144,150,899 (GRCm39) missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144,143,092 (GRCm39) missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144,154,219 (GRCm39) missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144,148,317 (GRCm39) missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144,150,871 (GRCm39) splice site probably null
R0835:Tecpr1 UTSW 5 144,149,410 (GRCm39) missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144,153,747 (GRCm39) missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144,143,357 (GRCm39) missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144,151,128 (GRCm39) missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144,134,762 (GRCm39) missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144,145,426 (GRCm39) missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144,143,347 (GRCm39) missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144,141,515 (GRCm39) missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144,148,274 (GRCm39) missense probably benign 0.10
R2172:Tecpr1 UTSW 5 144,133,235 (GRCm39) missense probably damaging 1.00
R2290:Tecpr1 UTSW 5 144,150,881 (GRCm39) missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144,146,797 (GRCm39) missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144,143,077 (GRCm39) missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144,144,255 (GRCm39) missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144,150,935 (GRCm39) missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144,141,476 (GRCm39) missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144,134,672 (GRCm39) splice site probably null
R5459:Tecpr1 UTSW 5 144,144,234 (GRCm39) missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144,151,162 (GRCm39) missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144,155,451 (GRCm39) nonsense probably null
R5679:Tecpr1 UTSW 5 144,144,241 (GRCm39) missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144,143,364 (GRCm39) missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144,148,239 (GRCm39) missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144,136,009 (GRCm39) missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144,141,458 (GRCm39) missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144,135,394 (GRCm39) missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144,153,776 (GRCm39) missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144,146,792 (GRCm39) missense probably benign
R7276:Tecpr1 UTSW 5 144,153,838 (GRCm39) nonsense probably null
R7314:Tecpr1 UTSW 5 144,154,150 (GRCm39) missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144,145,417 (GRCm39) missense possibly damaging 0.68
R7702:Tecpr1 UTSW 5 144,140,236 (GRCm39) missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144,135,420 (GRCm39) missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144,137,658 (GRCm39) missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144,150,845 (GRCm39) intron probably benign
R8926:Tecpr1 UTSW 5 144,153,780 (GRCm39) missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144,154,049 (GRCm39) missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144,155,396 (GRCm39) missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144,154,204 (GRCm39) missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144,155,409 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CACTACCTGATTCTCATAGGCC -3'
(R):5'- AACACACATTGCTTCTGGTTG -3'

Sequencing Primer
(F):5'- ATGGGTACATCACTGGAGCACAC -3'
(R):5'- AACACACATTGCTTCTGGTTGCTATG -3'
Posted On 2019-10-24