Mutagenetix > Incidental Mutation

Incidental Mutation 'R7632:Tecpr1'

589684

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 144218726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 5 (V5M)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

probably benign
Transcript: ENSMUST00000085701
AA Change: V5M

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: V5M

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap2a2	A	G	7: 141,631,323	D924G	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atrnl1	A	G	19: 57,630,306	D152G	probably damaging	Het
B3gnt8	A	G	7: 25,628,435	I97V	possibly damaging	Het
Bach1	A	G	16: 87,720,143	D524G	probably benign	Het
BC067074	C	A	13: 113,320,886	S1155R		Het
Caprin2	T	C	6: 148,883,456	S107G	probably damaging	Het
Ccnb1	A	G	13: 100,781,701	I207T	probably benign	Het
Cdh11	T	C	8: 102,673,883	D151G	probably damaging	Het
Cdh9	A	G	15: 16,851,029		probably null	Het
Cep83	A	T	10: 94,750,640	R433W	probably damaging	Het
D3Ertd751e	A	G	3: 41,753,728	E100G	probably benign	Het
Dchs2	C	T	3: 83,348,050	A2351V	probably benign	Het
Dhx40	T	C	11: 86,799,437	T253A	probably benign	Het
Dqx1	A	G	6: 83,059,699	D228G	probably benign	Het
Dync1h1	T	C	12: 110,660,893	M4002T	probably benign	Het
Flcn	C	T	11: 59,795,799	W376*	probably null	Het
Flnc	A	T	6: 29,446,985	Y1037F	probably damaging	Het
Fut11	T	A	14: 20,695,028	V9E	probably benign	Het
Fv1	T	A	4: 147,869,935	N319K	possibly damaging	Het
Ghrhr	G	T	6: 55,384,742	G298V	probably benign	Het
Gm5800	T	A	14: 51,716,448		probably null	Het
Grin2b	A	G	6: 135,732,555	M1331T	probably benign	Het
Hyou1	A	G	9: 44,381,136		probably null	Het
Igkv1-117	C	A	6: 68,121,808	Q114K	probably damaging	Het
Igkv4-68	A	G	6: 69,305,064	V41A	possibly damaging	Het
Inpp4b	A	G	8: 82,046,339	N754S	probably damaging	Het
Isl2	G	A	9: 55,541,156		probably null	Het
Kat2a	G	A	11: 100,708,596	Q523*	probably null	Het
Lypd3	T	C	7: 24,638,440	F77S	possibly damaging	Het
Map4k2	T	C	19: 6,344,054	L297P	probably benign	Het
Naca	T	C	10: 128,040,506	V469A	unknown	Het
Notch3	C	T	17: 32,158,506	V199I	probably benign	Het
Olfr1294	T	C	2: 111,538,176	I38V	possibly damaging	Het
Olfr1475	T	C	19: 13,479,431	M256V	possibly damaging	Het
Pabpc1	TGTACCTGTTGCATGGTA	TGTA	15: 36,597,968		probably null	Het
Pcdhb8	A	T	18: 37,355,595	I109L	probably benign	Het
Pde2a	A	G	7: 101,484,594	D104G	possibly damaging	Het
Phip	A	G	9: 82,903,190	V824A	probably benign	Het
Plekhg4	T	C	8: 105,380,150	Y853H	probably damaging	Het
Plod1	T	C	4: 147,927,024	K248R	probably damaging	Het
Plxnd1	A	T	6: 115,976,639	Y656N	probably benign	Het
Pogz	G	A	3: 94,856,206		probably null	Het
Ppp1r3e	T	A	14: 54,877,069	S79C	probably damaging	Het
Pprc1	T	A	19: 46,072,282	D1595E	probably damaging	Het
Ptprq	A	G	10: 107,711,922	V205A	probably benign	Het
Rad51ap2	T	C	12: 11,457,115	V346A	possibly damaging	Het
Rgs12	T	A	5: 34,965,590	L239H	probably damaging	Het
Rrp8	T	C	7: 105,736,520		probably benign	Het
Rsf1	GGCG	GGCGACCGCCGCG	7: 97,579,906		probably benign	Het
Scaf1	A	T	7: 45,007,079	V792D	unknown	Het
Scrn2	G	T	11: 97,033,142	R284L	possibly damaging	Het
Sgsm1	T	A	5: 113,276,082	Q461L	possibly damaging	Het
Slc18b1	A	G	10: 23,826,182	T434A	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Smc4	CTA	CTATA	3: 69,018,067		probably benign	Het
Snx33	A	T	9: 56,926,418	D122E	probably damaging	Het
Srebf2	G	T	15: 82,185,296	V680L	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Tfg	A	G	16: 56,712,634	V54A	possibly damaging	Het
Tmem237	C	T	1: 59,116,901	C30Y	probably benign	Het
Tmem245	T	C	4: 56,916,787	K444R	probably benign	Het
Trim25	T	G	11: 89,015,776	L446R	probably null	Het
Usp37	T	C	1: 74,468,374	T495A	probably benign	Het
Vmn1r94	T	G	7: 20,167,771	T203P	probably damaging	Het
Ywhah	T	A	5: 33,026,666	M71K	probably benign	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- CACTACCTGATTCTCATAGGCC -3'
(R):5'- AACACACATTGCTTCTGGTTG -3'

Sequencing Primer
(F):5'- ATGGGTACATCACTGGAGCACAC -3'
(R):5'- AACACACATTGCTTCTGGTTGCTATG -3'

Posted On

2019-10-24