Mutagenetix > Incidental Mutation

Incidental Mutation 'R7632:Plxnd1'

589690

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115976639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 656 (Y656N)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably benign
Transcript: ENSMUST00000015511
AA Change: Y656N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: Y656N

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap2a2	A	G	7: 141,631,323	D924G	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atrnl1	A	G	19: 57,630,306	D152G	probably damaging	Het
B3gnt8	A	G	7: 25,628,435	I97V	possibly damaging	Het
Bach1	A	G	16: 87,720,143	D524G	probably benign	Het
BC067074	C	A	13: 113,320,886	S1155R		Het
Caprin2	T	C	6: 148,883,456	S107G	probably damaging	Het
Ccnb1	A	G	13: 100,781,701	I207T	probably benign	Het
Cdh11	T	C	8: 102,673,883	D151G	probably damaging	Het
Cdh9	A	G	15: 16,851,029		probably null	Het
Cep83	A	T	10: 94,750,640	R433W	probably damaging	Het
D3Ertd751e	A	G	3: 41,753,728	E100G	probably benign	Het
Dchs2	C	T	3: 83,348,050	A2351V	probably benign	Het
Dhx40	T	C	11: 86,799,437	T253A	probably benign	Het
Dqx1	A	G	6: 83,059,699	D228G	probably benign	Het
Dync1h1	T	C	12: 110,660,893	M4002T	probably benign	Het
Flcn	C	T	11: 59,795,799	W376*	probably null	Het
Flnc	A	T	6: 29,446,985	Y1037F	probably damaging	Het
Fut11	T	A	14: 20,695,028	V9E	probably benign	Het
Fv1	T	A	4: 147,869,935	N319K	possibly damaging	Het
Ghrhr	G	T	6: 55,384,742	G298V	probably benign	Het
Gm5800	T	A	14: 51,716,448		probably null	Het
Grin2b	A	G	6: 135,732,555	M1331T	probably benign	Het
Hyou1	A	G	9: 44,381,136		probably null	Het
Igkv1-117	C	A	6: 68,121,808	Q114K	probably damaging	Het
Igkv4-68	A	G	6: 69,305,064	V41A	possibly damaging	Het
Inpp4b	A	G	8: 82,046,339	N754S	probably damaging	Het
Isl2	G	A	9: 55,541,156		probably null	Het
Kat2a	G	A	11: 100,708,596	Q523*	probably null	Het
Lypd3	T	C	7: 24,638,440	F77S	possibly damaging	Het
Map4k2	T	C	19: 6,344,054	L297P	probably benign	Het
Naca	T	C	10: 128,040,506	V469A	unknown	Het
Notch3	C	T	17: 32,158,506	V199I	probably benign	Het
Olfr1294	T	C	2: 111,538,176	I38V	possibly damaging	Het
Olfr1475	T	C	19: 13,479,431	M256V	possibly damaging	Het
Pabpc1	TGTACCTGTTGCATGGTA	TGTA	15: 36,597,968		probably null	Het
Pcdhb8	A	T	18: 37,355,595	I109L	probably benign	Het
Pde2a	A	G	7: 101,484,594	D104G	possibly damaging	Het
Phip	A	G	9: 82,903,190	V824A	probably benign	Het
Plekhg4	T	C	8: 105,380,150	Y853H	probably damaging	Het
Plod1	T	C	4: 147,927,024	K248R	probably damaging	Het
Pogz	G	A	3: 94,856,206		probably null	Het
Ppp1r3e	T	A	14: 54,877,069	S79C	probably damaging	Het
Pprc1	T	A	19: 46,072,282	D1595E	probably damaging	Het
Ptprq	A	G	10: 107,711,922	V205A	probably benign	Het
Rad51ap2	T	C	12: 11,457,115	V346A	possibly damaging	Het
Rgs12	T	A	5: 34,965,590	L239H	probably damaging	Het
Rrp8	T	C	7: 105,736,520		probably benign	Het
Rsf1	GGCG	GGCGACCGCCGCG	7: 97,579,906		probably benign	Het
Scaf1	A	T	7: 45,007,079	V792D	unknown	Het
Scrn2	G	T	11: 97,033,142	R284L	possibly damaging	Het
Sgsm1	T	A	5: 113,276,082	Q461L	possibly damaging	Het
Slc18b1	A	G	10: 23,826,182	T434A	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Smc4	CTA	CTATA	3: 69,018,067		probably benign	Het
Snx33	A	T	9: 56,926,418	D122E	probably damaging	Het
Srebf2	G	T	15: 82,185,296	V680L	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Tecpr1	C	T	5: 144,218,726	V5M	probably benign	Het
Tfg	A	G	16: 56,712,634	V54A	possibly damaging	Het
Tmem237	C	T	1: 59,116,901	C30Y	probably benign	Het
Tmem245	T	C	4: 56,916,787	K444R	probably benign	Het
Trim25	T	G	11: 89,015,776	L446R	probably null	Het
Usp37	T	C	1: 74,468,374	T495A	probably benign	Het
Vmn1r94	T	G	7: 20,167,771	T203P	probably damaging	Het
Ywhah	T	A	5: 33,026,666	M71K	probably benign	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
rattle	UTSW	6	115959794	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115962807	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115972545	nonsense	probably null
R9119:Plxnd1	UTSW	6	115955871	splice site	probably benign
R9177:Plxnd1	UTSW	6	115966508	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115993785	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115957565	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115957563	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115955769	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115963316	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GACAATGTTGTGTCCTTTGACCC -3'
(R):5'- AGACACTCAGGCAGGATCAG -3'

Sequencing Primer
(F):5'- TTTGACCCTTACAGACATCTCAACGG -3'
(R):5'- CTCAGGCAGGATCAGACAGATGC -3'

Posted On

2019-10-24