Incidental Mutation 'R7632:Rrp8'
ID589699
Institutional Source Beutler Lab
Gene Symbol Rrp8
Ensembl Gene ENSMUSG00000030888
Gene Nameribosomal RNA processing 8, methyltransferase, homolog (yeast)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R7632 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105731730-105737385 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 105736520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033179] [ENSMUST00000033182] [ENSMUST00000098148] [ENSMUST00000136687] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect probably benign
Transcript: ENSMUST00000033179
SMART Domains Protein: ENSMUSP00000033179
Gene: ENSMUSG00000030888

DomainStartEndE-ValueType
low complexity region 186 202 N/A INTRINSIC
Pfam:Methyltransf_8 238 457 2.4e-107 PFAM
Pfam:Methyltransf_11 314 391 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033182
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098148
SMART Domains Protein: ENSMUSP00000095752
Gene: ENSMUSG00000030888

DomainStartEndE-ValueType
low complexity region 232 248 N/A INTRINSIC
Pfam:Methyltransf_8 284 503 7.5e-107 PFAM
Pfam:Methyltransf_11 348 437 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127298
Predicted Effect probably benign
Transcript: ENSMUST00000127738
Predicted Effect probably benign
Transcript: ENSMUST00000136687
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect probably benign
Transcript: ENSMUST00000153557
Predicted Effect probably benign
Transcript: ENSMUST00000163389
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,631,323 D924G probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
B3gnt8 A G 7: 25,628,435 I97V possibly damaging Het
Bach1 A G 16: 87,720,143 D524G probably benign Het
BC067074 C A 13: 113,320,886 S1155R Het
Caprin2 T C 6: 148,883,456 S107G probably damaging Het
Ccnb1 A G 13: 100,781,701 I207T probably benign Het
Cdh11 T C 8: 102,673,883 D151G probably damaging Het
Cdh9 A G 15: 16,851,029 probably null Het
Cep83 A T 10: 94,750,640 R433W probably damaging Het
D3Ertd751e A G 3: 41,753,728 E100G probably benign Het
Dchs2 C T 3: 83,348,050 A2351V probably benign Het
Dhx40 T C 11: 86,799,437 T253A probably benign Het
Dqx1 A G 6: 83,059,699 D228G probably benign Het
Dync1h1 T C 12: 110,660,893 M4002T probably benign Het
Flcn C T 11: 59,795,799 W376* probably null Het
Flnc A T 6: 29,446,985 Y1037F probably damaging Het
Fut11 T A 14: 20,695,028 V9E probably benign Het
Fv1 T A 4: 147,869,935 N319K possibly damaging Het
Ghrhr G T 6: 55,384,742 G298V probably benign Het
Gm5800 T A 14: 51,716,448 probably null Het
Grin2b A G 6: 135,732,555 M1331T probably benign Het
Hyou1 A G 9: 44,381,136 probably null Het
Igkv1-117 C A 6: 68,121,808 Q114K probably damaging Het
Igkv4-68 A G 6: 69,305,064 V41A possibly damaging Het
Inpp4b A G 8: 82,046,339 N754S probably damaging Het
Isl2 G A 9: 55,541,156 probably null Het
Kat2a G A 11: 100,708,596 Q523* probably null Het
Lypd3 T C 7: 24,638,440 F77S possibly damaging Het
Map4k2 T C 19: 6,344,054 L297P probably benign Het
Naca T C 10: 128,040,506 V469A unknown Het
Notch3 C T 17: 32,158,506 V199I probably benign Het
Olfr1294 T C 2: 111,538,176 I38V possibly damaging Het
Olfr1475 T C 19: 13,479,431 M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,597,968 probably null Het
Pcdhb8 A T 18: 37,355,595 I109L probably benign Het
Pde2a A G 7: 101,484,594 D104G possibly damaging Het
Phip A G 9: 82,903,190 V824A probably benign Het
Plekhg4 T C 8: 105,380,150 Y853H probably damaging Het
Plod1 T C 4: 147,927,024 K248R probably damaging Het
Plxnd1 A T 6: 115,976,639 Y656N probably benign Het
Pogz G A 3: 94,856,206 probably null Het
Ppp1r3e T A 14: 54,877,069 S79C probably damaging Het
Pprc1 T A 19: 46,072,282 D1595E probably damaging Het
Ptprq A G 10: 107,711,922 V205A probably benign Het
Rad51ap2 T C 12: 11,457,115 V346A possibly damaging Het
Rgs12 T A 5: 34,965,590 L239H probably damaging Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,579,906 probably benign Het
Scaf1 A T 7: 45,007,079 V792D unknown Het
Scrn2 G T 11: 97,033,142 R284L possibly damaging Het
Sgsm1 T A 5: 113,276,082 Q461L possibly damaging Het
Slc18b1 A G 10: 23,826,182 T434A probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Snx33 A T 9: 56,926,418 D122E probably damaging Het
Srebf2 G T 15: 82,185,296 V680L probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Tecpr1 C T 5: 144,218,726 V5M probably benign Het
Tfg A G 16: 56,712,634 V54A possibly damaging Het
Tmem237 C T 1: 59,116,901 C30Y probably benign Het
Tmem245 T C 4: 56,916,787 K444R probably benign Het
Trim25 T G 11: 89,015,776 L446R probably null Het
Usp37 T C 1: 74,468,374 T495A probably benign Het
Vmn1r94 T G 7: 20,167,771 T203P probably damaging Het
Ywhah T A 5: 33,026,666 M71K probably benign Het
Other mutations in Rrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rrp8 APN 7 105733016 unclassified probably benign
IGL02792:Rrp8 APN 7 105733811 nonsense probably null
IGL03010:Rrp8 APN 7 105734391 missense probably benign 0.01
IGL03404:Rrp8 APN 7 105734938 missense probably benign 0.41
IGL03046:Rrp8 UTSW 7 105734902 missense probably benign 0.00
R0682:Rrp8 UTSW 7 105734011 missense probably damaging 0.97
R2314:Rrp8 UTSW 7 105734804 missense probably benign 0.37
R4222:Rrp8 UTSW 7 105734022 missense possibly damaging 0.86
R4778:Rrp8 UTSW 7 105737274 intron probably benign
R4940:Rrp8 UTSW 7 105734077 nonsense probably null
R5315:Rrp8 UTSW 7 105734000 missense probably benign 0.00
R5480:Rrp8 UTSW 7 105734129 missense probably damaging 1.00
R5630:Rrp8 UTSW 7 105733401 missense possibly damaging 0.83
R6266:Rrp8 UTSW 7 105736389 missense probably damaging 1.00
R6351:Rrp8 UTSW 7 105734809 missense probably damaging 0.99
R6353:Rrp8 UTSW 7 105734118 nonsense probably null
R7070:Rrp8 UTSW 7 105734876 missense possibly damaging 0.90
R7092:Rrp8 UTSW 7 105734109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCAAACAGCCCAGTG -3'
(R):5'- AGACGGGTTTGCAAGACAGC -3'

Sequencing Primer
(F):5'- TAACCTGTGCTGTCGCG -3'
(R):5'- TTTGCAAGACAGCGTGGG -3'
Posted On2019-10-24