Incidental Mutation 'R7632:Cdh11'
ID 589702
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Name cadherin 11
Synonyms Cad11, osteoblast-cadherin, OB-cadherin
MMRRC Submission 045720-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7632 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 103358727-103512125 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103400515 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 151 (D151G)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
AlphaFold P55288
PDB Structure Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075190
AA Change: D151G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: D151G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Meta Mutation Damage Score 0.9338 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,211,236 (GRCm39) D924G probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atrnl1 A G 19: 57,618,738 (GRCm39) D152G probably damaging Het
B3gnt8 A G 7: 25,327,860 (GRCm39) I97V possibly damaging Het
Bach1 A G 16: 87,517,031 (GRCm39) D524G probably benign Het
Caprin2 T C 6: 148,784,954 (GRCm39) S107G probably damaging Het
Ccnb1 A G 13: 100,918,209 (GRCm39) I207T probably benign Het
Cdh9 A G 15: 16,851,115 (GRCm39) probably null Het
Cep83 A T 10: 94,586,502 (GRCm39) R433W probably damaging Het
Cspg4b C A 13: 113,457,420 (GRCm39) S1155R Het
D3Ertd751e A G 3: 41,708,163 (GRCm39) E100G probably benign Het
Dchs2 C T 3: 83,255,357 (GRCm39) A2351V probably benign Het
Dhx40 T C 11: 86,690,263 (GRCm39) T253A probably benign Het
Dqx1 A G 6: 83,036,680 (GRCm39) D228G probably benign Het
Dync1h1 T C 12: 110,627,327 (GRCm39) M4002T probably benign Het
Flcn C T 11: 59,686,625 (GRCm39) W376* probably null Het
Flnc A T 6: 29,446,984 (GRCm39) Y1037F probably damaging Het
Fut11 T A 14: 20,745,096 (GRCm39) V9E probably benign Het
Fv1 T A 4: 147,954,392 (GRCm39) N319K possibly damaging Het
Ghrhr G T 6: 55,361,727 (GRCm39) G298V probably benign Het
Gm5800 T A 14: 51,953,905 (GRCm39) probably null Het
Grin2b A G 6: 135,709,553 (GRCm39) M1331T probably benign Het
Hyou1 A G 9: 44,292,433 (GRCm39) probably null Het
Igkv1-117 C A 6: 68,098,792 (GRCm39) Q114K probably damaging Het
Igkv4-68 A G 6: 69,282,048 (GRCm39) V41A possibly damaging Het
Inpp4b A G 8: 82,772,968 (GRCm39) N754S probably damaging Het
Isl2 G A 9: 55,448,440 (GRCm39) probably null Het
Kat2a G A 11: 100,599,422 (GRCm39) Q523* probably null Het
Lypd3 T C 7: 24,337,865 (GRCm39) F77S possibly damaging Het
Map4k2 T C 19: 6,394,084 (GRCm39) L297P probably benign Het
Naca T C 10: 127,876,375 (GRCm39) V469A unknown Het
Notch3 C T 17: 32,377,480 (GRCm39) V199I probably benign Het
Or4k44 T C 2: 111,368,521 (GRCm39) I38V possibly damaging Het
Or5b119 T C 19: 13,456,795 (GRCm39) M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,598,212 (GRCm39) probably null Het
Pcdhb8 A T 18: 37,488,648 (GRCm39) I109L probably benign Het
Pde2a A G 7: 101,133,801 (GRCm39) D104G possibly damaging Het
Phip A G 9: 82,785,243 (GRCm39) V824A probably benign Het
Plekhg4 T C 8: 106,106,782 (GRCm39) Y853H probably damaging Het
Plod1 T C 4: 148,011,481 (GRCm39) K248R probably damaging Het
Plxnd1 A T 6: 115,953,600 (GRCm39) Y656N probably benign Het
Pogz G A 3: 94,763,517 (GRCm39) probably null Het
Ppp1r3e T A 14: 55,114,526 (GRCm39) S79C probably damaging Het
Pprc1 T A 19: 46,060,721 (GRCm39) D1595E probably damaging Het
Ptprq A G 10: 107,547,783 (GRCm39) V205A probably benign Het
Rad51ap2 T C 12: 11,507,116 (GRCm39) V346A possibly damaging Het
Rgs12 T A 5: 35,122,934 (GRCm39) L239H probably damaging Het
Rrp8 T C 7: 105,385,727 (GRCm39) probably benign Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Scaf1 A T 7: 44,656,503 (GRCm39) V792D unknown Het
Scrn2 G T 11: 96,923,968 (GRCm39) R284L possibly damaging Het
Sgsm1 T A 5: 113,423,948 (GRCm39) Q461L possibly damaging Het
Slc18b1 A G 10: 23,702,080 (GRCm39) T434A probably benign Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Snx33 A T 9: 56,833,702 (GRCm39) D122E probably damaging Het
Srebf2 G T 15: 82,069,497 (GRCm39) V680L probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Tecpr1 C T 5: 144,155,544 (GRCm39) V5M probably benign Het
Tfg A G 16: 56,532,997 (GRCm39) V54A possibly damaging Het
Tmem237 C T 1: 59,156,060 (GRCm39) C30Y probably benign Het
Tmem245 T C 4: 56,916,787 (GRCm39) K444R probably benign Het
Trim25 T G 11: 88,906,602 (GRCm39) L446R probably null Het
Usp37 T C 1: 74,507,533 (GRCm39) T495A probably benign Het
Vmn1r94 T G 7: 19,901,696 (GRCm39) T203P probably damaging Het
Ywhah T A 5: 33,184,010 (GRCm39) M71K probably benign Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 103,377,281 (GRCm39) missense probably damaging 1.00
IGL01019:Cdh11 APN 8 103,406,377 (GRCm39) missense probably benign
IGL01286:Cdh11 APN 8 103,391,261 (GRCm39) missense probably damaging 0.98
IGL01556:Cdh11 APN 8 103,406,276 (GRCm39) missense probably damaging 1.00
IGL01964:Cdh11 APN 8 103,391,375 (GRCm39) missense probably benign 0.03
IGL02322:Cdh11 APN 8 103,374,151 (GRCm39) missense probably benign 0.01
IGL03094:Cdh11 APN 8 103,385,035 (GRCm39) missense probably benign
IGL03110:Cdh11 APN 8 103,400,502 (GRCm39) missense probably damaging 1.00
IGL03391:Cdh11 APN 8 103,400,655 (GRCm39) missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 103,400,638 (GRCm39) missense probably damaging 1.00
R0466:Cdh11 UTSW 8 103,396,690 (GRCm39) missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 103,394,651 (GRCm39) missense probably damaging 1.00
R0925:Cdh11 UTSW 8 103,361,356 (GRCm39) missense probably damaging 1.00
R1597:Cdh11 UTSW 8 103,377,343 (GRCm39) missense probably benign 0.06
R1624:Cdh11 UTSW 8 103,391,233 (GRCm39) splice site probably benign
R1829:Cdh11 UTSW 8 103,361,273 (GRCm39) missense possibly damaging 0.92
R2029:Cdh11 UTSW 8 103,406,404 (GRCm39) missense probably benign 0.00
R4191:Cdh11 UTSW 8 103,377,380 (GRCm39) missense probably damaging 0.98
R4270:Cdh11 UTSW 8 103,391,258 (GRCm39) missense possibly damaging 0.69
R4271:Cdh11 UTSW 8 103,391,258 (GRCm39) missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 103,374,455 (GRCm39) missense probably benign
R4516:Cdh11 UTSW 8 103,400,594 (GRCm39) missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 103,374,090 (GRCm39) splice site probably null
R5441:Cdh11 UTSW 8 103,374,178 (GRCm39) missense probably benign 0.11
R5699:Cdh11 UTSW 8 103,361,175 (GRCm39) missense probably damaging 0.96
R6170:Cdh11 UTSW 8 103,361,442 (GRCm39) missense probably benign 0.00
R6846:Cdh11 UTSW 8 103,391,276 (GRCm39) missense probably damaging 0.97
R7018:Cdh11 UTSW 8 103,360,953 (GRCm39) missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 103,384,899 (GRCm39) missense probably damaging 1.00
R7497:Cdh11 UTSW 8 103,400,456 (GRCm39) missense probably benign 0.00
R7715:Cdh11 UTSW 8 103,391,346 (GRCm39) missense possibly damaging 0.66
R8321:Cdh11 UTSW 8 103,361,416 (GRCm39) missense probably damaging 0.99
R8529:Cdh11 UTSW 8 103,391,387 (GRCm39) missense probably benign 0.01
R8530:Cdh11 UTSW 8 103,391,387 (GRCm39) missense probably benign 0.01
R8682:Cdh11 UTSW 8 103,377,348 (GRCm39) missense probably benign 0.24
R9105:Cdh11 UTSW 8 103,360,968 (GRCm39) missense probably damaging 0.99
R9404:Cdh11 UTSW 8 103,406,254 (GRCm39) missense probably damaging 1.00
R9660:Cdh11 UTSW 8 103,384,879 (GRCm39) missense possibly damaging 0.70
R9684:Cdh11 UTSW 8 103,391,327 (GRCm39) missense probably benign 0.04
R9721:Cdh11 UTSW 8 103,406,257 (GRCm39) missense probably damaging 1.00
R9802:Cdh11 UTSW 8 103,391,276 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAACACAAGCTCTGCTTCCTGG -3'
(R):5'- GTGTGACTGTATGTATGTGCACAC -3'

Sequencing Primer
(F):5'- ACAAGCTCTGCTTCCTGGGTTAG -3'
(R):5'- TACATTCTCTCAGGTGAAGGAGC -3'
Posted On 2019-10-24