Incidental Mutation 'R7632:Cdh11'
ID589702
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Namecadherin 11
Synonymsosteoblast-cadherin, Cad11, OB-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7632 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location102632095-102785642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102673883 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 151 (D151G)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
PDB Structure
Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075190
AA Change: D151G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: D151G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Meta Mutation Damage Score 0.9338 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,631,323 D924G probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
B3gnt8 A G 7: 25,628,435 I97V possibly damaging Het
Bach1 A G 16: 87,720,143 D524G probably benign Het
BC067074 C A 13: 113,320,886 S1155R Het
Caprin2 T C 6: 148,883,456 S107G probably damaging Het
Ccnb1 A G 13: 100,781,701 I207T probably benign Het
Cdh9 A G 15: 16,851,029 probably null Het
Cep83 A T 10: 94,750,640 R433W probably damaging Het
D3Ertd751e A G 3: 41,753,728 E100G probably benign Het
Dchs2 C T 3: 83,348,050 A2351V probably benign Het
Dhx40 T C 11: 86,799,437 T253A probably benign Het
Dqx1 A G 6: 83,059,699 D228G probably benign Het
Dync1h1 T C 12: 110,660,893 M4002T probably benign Het
Flcn C T 11: 59,795,799 W376* probably null Het
Flnc A T 6: 29,446,985 Y1037F probably damaging Het
Fut11 T A 14: 20,695,028 V9E probably benign Het
Fv1 T A 4: 147,869,935 N319K possibly damaging Het
Ghrhr G T 6: 55,384,742 G298V probably benign Het
Gm5800 T A 14: 51,716,448 probably null Het
Grin2b A G 6: 135,732,555 M1331T probably benign Het
Hyou1 A G 9: 44,381,136 probably null Het
Igkv1-117 C A 6: 68,121,808 Q114K probably damaging Het
Igkv4-68 A G 6: 69,305,064 V41A possibly damaging Het
Inpp4b A G 8: 82,046,339 N754S probably damaging Het
Isl2 G A 9: 55,541,156 probably null Het
Kat2a G A 11: 100,708,596 Q523* probably null Het
Lypd3 T C 7: 24,638,440 F77S possibly damaging Het
Map4k2 T C 19: 6,344,054 L297P probably benign Het
Naca T C 10: 128,040,506 V469A unknown Het
Notch3 C T 17: 32,158,506 V199I probably benign Het
Olfr1294 T C 2: 111,538,176 I38V possibly damaging Het
Olfr1475 T C 19: 13,479,431 M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,597,968 probably null Het
Pcdhb8 A T 18: 37,355,595 I109L probably benign Het
Pde2a A G 7: 101,484,594 D104G possibly damaging Het
Phip A G 9: 82,903,190 V824A probably benign Het
Plekhg4 T C 8: 105,380,150 Y853H probably damaging Het
Plod1 T C 4: 147,927,024 K248R probably damaging Het
Plxnd1 A T 6: 115,976,639 Y656N probably benign Het
Pogz G A 3: 94,856,206 probably null Het
Ppp1r3e T A 14: 54,877,069 S79C probably damaging Het
Pprc1 T A 19: 46,072,282 D1595E probably damaging Het
Ptprq A G 10: 107,711,922 V205A probably benign Het
Rad51ap2 T C 12: 11,457,115 V346A possibly damaging Het
Rgs12 T A 5: 34,965,590 L239H probably damaging Het
Rrp8 T C 7: 105,736,520 probably benign Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,579,906 probably benign Het
Scaf1 A T 7: 45,007,079 V792D unknown Het
Scrn2 G T 11: 97,033,142 R284L possibly damaging Het
Sgsm1 T A 5: 113,276,082 Q461L possibly damaging Het
Slc18b1 A G 10: 23,826,182 T434A probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Snx33 A T 9: 56,926,418 D122E probably damaging Het
Srebf2 G T 15: 82,185,296 V680L probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Tecpr1 C T 5: 144,218,726 V5M probably benign Het
Tfg A G 16: 56,712,634 V54A possibly damaging Het
Tmem237 C T 1: 59,116,901 C30Y probably benign Het
Tmem245 T C 4: 56,916,787 K444R probably benign Het
Trim25 T G 11: 89,015,776 L446R probably null Het
Usp37 T C 1: 74,468,374 T495A probably benign Het
Vmn1r94 T G 7: 20,167,771 T203P probably damaging Het
Ywhah T A 5: 33,026,666 M71K probably benign Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 102650649 missense probably damaging 1.00
IGL01019:Cdh11 APN 8 102679745 missense probably benign
IGL01286:Cdh11 APN 8 102664629 missense probably damaging 0.98
IGL01556:Cdh11 APN 8 102679644 missense probably damaging 1.00
IGL01964:Cdh11 APN 8 102664743 missense probably benign 0.03
IGL02322:Cdh11 APN 8 102647519 missense probably benign 0.01
IGL03094:Cdh11 APN 8 102658403 missense probably benign
IGL03110:Cdh11 APN 8 102673870 missense probably damaging 1.00
IGL03391:Cdh11 APN 8 102674023 missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 102674006 missense probably damaging 1.00
R0466:Cdh11 UTSW 8 102670058 missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 102668019 missense probably damaging 1.00
R0925:Cdh11 UTSW 8 102634724 missense probably damaging 1.00
R1597:Cdh11 UTSW 8 102650711 missense probably benign 0.06
R1624:Cdh11 UTSW 8 102664601 splice site probably benign
R1829:Cdh11 UTSW 8 102634641 missense possibly damaging 0.92
R2029:Cdh11 UTSW 8 102679772 missense probably benign 0.00
R4191:Cdh11 UTSW 8 102650748 missense probably damaging 0.98
R4270:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4271:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 102647823 missense probably benign
R4516:Cdh11 UTSW 8 102673962 missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 102647458 splice site probably null
R5441:Cdh11 UTSW 8 102647546 missense probably benign 0.11
R5699:Cdh11 UTSW 8 102634543 missense probably damaging 0.96
R6170:Cdh11 UTSW 8 102634810 missense probably benign 0.00
R6846:Cdh11 UTSW 8 102664644 missense probably damaging 0.97
R7018:Cdh11 UTSW 8 102634321 missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 102658267 missense probably damaging 1.00
R7497:Cdh11 UTSW 8 102673824 missense probably benign 0.00
R7715:Cdh11 UTSW 8 102664714 missense possibly damaging 0.66
R8321:Cdh11 UTSW 8 102634784 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAACACAAGCTCTGCTTCCTGG -3'
(R):5'- GTGTGACTGTATGTATGTGCACAC -3'

Sequencing Primer
(F):5'- ACAAGCTCTGCTTCCTGGGTTAG -3'
(R):5'- TACATTCTCTCAGGTGAAGGAGC -3'
Posted On2019-10-24