Incidental Mutation 'R7632:Ptprq'
ID 589709
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Name protein tyrosine phosphatase receptor type Q
Synonyms
MMRRC Submission 045720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.236) question?
Stock # R7632 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 107352910-107555912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107547783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 205 (V205A)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
AlphaFold P0C5E4
Predicted Effect probably benign
Transcript: ENSMUST00000050702
AA Change: V205A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: V205A

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,211,236 (GRCm39) D924G probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atrnl1 A G 19: 57,618,738 (GRCm39) D152G probably damaging Het
B3gnt8 A G 7: 25,327,860 (GRCm39) I97V possibly damaging Het
Bach1 A G 16: 87,517,031 (GRCm39) D524G probably benign Het
Caprin2 T C 6: 148,784,954 (GRCm39) S107G probably damaging Het
Ccnb1 A G 13: 100,918,209 (GRCm39) I207T probably benign Het
Cdh11 T C 8: 103,400,515 (GRCm39) D151G probably damaging Het
Cdh9 A G 15: 16,851,115 (GRCm39) probably null Het
Cep83 A T 10: 94,586,502 (GRCm39) R433W probably damaging Het
Cspg4b C A 13: 113,457,420 (GRCm39) S1155R Het
D3Ertd751e A G 3: 41,708,163 (GRCm39) E100G probably benign Het
Dchs2 C T 3: 83,255,357 (GRCm39) A2351V probably benign Het
Dhx40 T C 11: 86,690,263 (GRCm39) T253A probably benign Het
Dqx1 A G 6: 83,036,680 (GRCm39) D228G probably benign Het
Dync1h1 T C 12: 110,627,327 (GRCm39) M4002T probably benign Het
Flcn C T 11: 59,686,625 (GRCm39) W376* probably null Het
Flnc A T 6: 29,446,984 (GRCm39) Y1037F probably damaging Het
Fut11 T A 14: 20,745,096 (GRCm39) V9E probably benign Het
Fv1 T A 4: 147,954,392 (GRCm39) N319K possibly damaging Het
Ghrhr G T 6: 55,361,727 (GRCm39) G298V probably benign Het
Gm5800 T A 14: 51,953,905 (GRCm39) probably null Het
Grin2b A G 6: 135,709,553 (GRCm39) M1331T probably benign Het
Hyou1 A G 9: 44,292,433 (GRCm39) probably null Het
Igkv1-117 C A 6: 68,098,792 (GRCm39) Q114K probably damaging Het
Igkv4-68 A G 6: 69,282,048 (GRCm39) V41A possibly damaging Het
Inpp4b A G 8: 82,772,968 (GRCm39) N754S probably damaging Het
Isl2 G A 9: 55,448,440 (GRCm39) probably null Het
Kat2a G A 11: 100,599,422 (GRCm39) Q523* probably null Het
Lypd3 T C 7: 24,337,865 (GRCm39) F77S possibly damaging Het
Map4k2 T C 19: 6,394,084 (GRCm39) L297P probably benign Het
Naca T C 10: 127,876,375 (GRCm39) V469A unknown Het
Notch3 C T 17: 32,377,480 (GRCm39) V199I probably benign Het
Or4k44 T C 2: 111,368,521 (GRCm39) I38V possibly damaging Het
Or5b119 T C 19: 13,456,795 (GRCm39) M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,598,212 (GRCm39) probably null Het
Pcdhb8 A T 18: 37,488,648 (GRCm39) I109L probably benign Het
Pde2a A G 7: 101,133,801 (GRCm39) D104G possibly damaging Het
Phip A G 9: 82,785,243 (GRCm39) V824A probably benign Het
Plekhg4 T C 8: 106,106,782 (GRCm39) Y853H probably damaging Het
Plod1 T C 4: 148,011,481 (GRCm39) K248R probably damaging Het
Plxnd1 A T 6: 115,953,600 (GRCm39) Y656N probably benign Het
Pogz G A 3: 94,763,517 (GRCm39) probably null Het
Ppp1r3e T A 14: 55,114,526 (GRCm39) S79C probably damaging Het
Pprc1 T A 19: 46,060,721 (GRCm39) D1595E probably damaging Het
Rad51ap2 T C 12: 11,507,116 (GRCm39) V346A possibly damaging Het
Rgs12 T A 5: 35,122,934 (GRCm39) L239H probably damaging Het
Rrp8 T C 7: 105,385,727 (GRCm39) probably benign Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Scaf1 A T 7: 44,656,503 (GRCm39) V792D unknown Het
Scrn2 G T 11: 96,923,968 (GRCm39) R284L possibly damaging Het
Sgsm1 T A 5: 113,423,948 (GRCm39) Q461L possibly damaging Het
Slc18b1 A G 10: 23,702,080 (GRCm39) T434A probably benign Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Snx33 A T 9: 56,833,702 (GRCm39) D122E probably damaging Het
Srebf2 G T 15: 82,069,497 (GRCm39) V680L probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Tecpr1 C T 5: 144,155,544 (GRCm39) V5M probably benign Het
Tfg A G 16: 56,532,997 (GRCm39) V54A possibly damaging Het
Tmem237 C T 1: 59,156,060 (GRCm39) C30Y probably benign Het
Tmem245 T C 4: 56,916,787 (GRCm39) K444R probably benign Het
Trim25 T G 11: 88,906,602 (GRCm39) L446R probably null Het
Usp37 T C 1: 74,507,533 (GRCm39) T495A probably benign Het
Vmn1r94 T G 7: 19,901,696 (GRCm39) T203P probably damaging Het
Ywhah T A 5: 33,184,010 (GRCm39) M71K probably benign Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107,412,790 (GRCm39) missense probably damaging 0.98
IGL00537:Ptprq APN 10 107,546,383 (GRCm39) missense probably benign 0.07
IGL00547:Ptprq APN 10 107,554,402 (GRCm39) missense probably damaging 0.99
IGL00586:Ptprq APN 10 107,443,983 (GRCm39) splice site probably benign
IGL00648:Ptprq APN 10 107,482,577 (GRCm39) missense probably benign 0.10
IGL01123:Ptprq APN 10 107,522,079 (GRCm39) missense probably damaging 0.96
IGL01343:Ptprq APN 10 107,474,700 (GRCm39) missense probably damaging 0.96
IGL01348:Ptprq APN 10 107,547,765 (GRCm39) missense probably damaging 1.00
IGL01433:Ptprq APN 10 107,412,741 (GRCm39) missense probably damaging 0.99
IGL01510:Ptprq APN 10 107,547,909 (GRCm39) missense probably damaging 1.00
IGL01535:Ptprq APN 10 107,535,457 (GRCm39) missense probably benign
IGL01631:Ptprq APN 10 107,479,399 (GRCm39) missense probably benign 0.00
IGL01633:Ptprq APN 10 107,535,584 (GRCm39) splice site probably benign
IGL01702:Ptprq APN 10 107,353,727 (GRCm39) missense probably benign 0.00
IGL01733:Ptprq APN 10 107,498,460 (GRCm39) missense probably benign 0.10
IGL01806:Ptprq APN 10 107,535,469 (GRCm39) missense probably damaging 1.00
IGL01832:Ptprq APN 10 107,401,700 (GRCm39) critical splice donor site probably null
IGL01961:Ptprq APN 10 107,479,515 (GRCm39) missense probably damaging 1.00
IGL02108:Ptprq APN 10 107,482,478 (GRCm39) missense probably damaging 1.00
IGL02120:Ptprq APN 10 107,503,333 (GRCm39) missense probably damaging 1.00
IGL02160:Ptprq APN 10 107,489,426 (GRCm39) missense probably benign 0.00
IGL02178:Ptprq APN 10 107,522,180 (GRCm39) missense probably benign 0.03
IGL02249:Ptprq APN 10 107,418,220 (GRCm39) missense probably damaging 1.00
IGL02267:Ptprq APN 10 107,482,419 (GRCm39) missense probably damaging 1.00
IGL02527:Ptprq APN 10 107,522,424 (GRCm39) missense probably benign 0.04
IGL02529:Ptprq APN 10 107,471,226 (GRCm39) missense probably benign 0.03
IGL02542:Ptprq APN 10 107,498,416 (GRCm39) missense probably damaging 1.00
IGL02582:Ptprq APN 10 107,479,860 (GRCm39) missense probably benign 0.00
IGL02708:Ptprq APN 10 107,488,561 (GRCm39) missense probably damaging 1.00
IGL02894:Ptprq APN 10 107,503,285 (GRCm39) missense probably benign
IGL02903:Ptprq APN 10 107,502,447 (GRCm39) missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107,503,321 (GRCm39) missense probably benign 0.03
IGL02982:Ptprq APN 10 107,422,545 (GRCm39) missense probably damaging 1.00
IGL03000:Ptprq APN 10 107,378,518 (GRCm39) missense probably damaging 1.00
IGL03024:Ptprq APN 10 107,521,427 (GRCm39) missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107,524,368 (GRCm39) missense probably benign
P0043:Ptprq UTSW 10 107,416,086 (GRCm39) missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107,502,428 (GRCm39) missense probably damaging 1.00
R0200:Ptprq UTSW 10 107,521,018 (GRCm39) missense probably benign
R0268:Ptprq UTSW 10 107,541,409 (GRCm39) missense probably benign
R0276:Ptprq UTSW 10 107,378,596 (GRCm39) critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107,444,278 (GRCm39) missense probably damaging 0.96
R0335:Ptprq UTSW 10 107,544,589 (GRCm39) missense probably benign
R0344:Ptprq UTSW 10 107,541,443 (GRCm39) missense probably benign
R0357:Ptprq UTSW 10 107,522,060 (GRCm39) splice site probably benign
R0454:Ptprq UTSW 10 107,418,391 (GRCm39) nonsense probably null
R0479:Ptprq UTSW 10 107,479,855 (GRCm39) nonsense probably null
R0491:Ptprq UTSW 10 107,444,036 (GRCm39) missense probably damaging 0.98
R0519:Ptprq UTSW 10 107,374,781 (GRCm39) splice site probably benign
R0523:Ptprq UTSW 10 107,416,081 (GRCm39) missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107,546,488 (GRCm39) missense probably benign 0.33
R0746:Ptprq UTSW 10 107,353,692 (GRCm39) missense probably damaging 1.00
R0755:Ptprq UTSW 10 107,418,400 (GRCm39) missense probably benign 0.09
R1434:Ptprq UTSW 10 107,422,575 (GRCm39) missense probably damaging 1.00
R1445:Ptprq UTSW 10 107,498,423 (GRCm39) missense probably damaging 1.00
R1470:Ptprq UTSW 10 107,554,435 (GRCm39) missense probably damaging 0.97
R1470:Ptprq UTSW 10 107,554,435 (GRCm39) missense probably damaging 0.97
R1558:Ptprq UTSW 10 107,479,904 (GRCm39) missense probably damaging 1.00
R1567:Ptprq UTSW 10 107,401,748 (GRCm39) missense probably benign 0.13
R1711:Ptprq UTSW 10 107,370,560 (GRCm39) nonsense probably null
R1720:Ptprq UTSW 10 107,522,155 (GRCm39) missense probably damaging 1.00
R1746:Ptprq UTSW 10 107,474,691 (GRCm39) missense probably damaging 1.00
R1776:Ptprq UTSW 10 107,520,950 (GRCm39) missense probably damaging 1.00
R1822:Ptprq UTSW 10 107,554,339 (GRCm39) missense probably damaging 1.00
R1872:Ptprq UTSW 10 107,479,860 (GRCm39) missense probably benign 0.19
R1944:Ptprq UTSW 10 107,418,249 (GRCm39) missense probably benign 0.23
R1945:Ptprq UTSW 10 107,418,249 (GRCm39) missense probably benign 0.23
R2006:Ptprq UTSW 10 107,502,407 (GRCm39) missense probably damaging 1.00
R2014:Ptprq UTSW 10 107,503,283 (GRCm39) missense probably damaging 0.96
R2015:Ptprq UTSW 10 107,503,283 (GRCm39) missense probably damaging 0.96
R2097:Ptprq UTSW 10 107,489,354 (GRCm39) missense probably benign 0.05
R2172:Ptprq UTSW 10 107,426,855 (GRCm39) nonsense probably null
R2174:Ptprq UTSW 10 107,541,414 (GRCm39) missense probably damaging 1.00
R2248:Ptprq UTSW 10 107,478,931 (GRCm39) splice site probably null
R2404:Ptprq UTSW 10 107,522,460 (GRCm39) missense probably damaging 1.00
R3423:Ptprq UTSW 10 107,418,337 (GRCm39) missense probably damaging 0.99
R3683:Ptprq UTSW 10 107,544,489 (GRCm39) missense probably benign 0.01
R3875:Ptprq UTSW 10 107,520,965 (GRCm39) missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107,522,253 (GRCm39) splice site probably benign
R3946:Ptprq UTSW 10 107,522,253 (GRCm39) splice site probably benign
R3974:Ptprq UTSW 10 107,547,923 (GRCm39) missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107,379,257 (GRCm39) missense probably damaging 0.99
R4105:Ptprq UTSW 10 107,408,828 (GRCm39) missense probably damaging 1.00
R4118:Ptprq UTSW 10 107,547,781 (GRCm39) missense probably benign 0.37
R4175:Ptprq UTSW 10 107,547,778 (GRCm39) missense probably benign
R4231:Ptprq UTSW 10 107,522,144 (GRCm39) nonsense probably null
R4356:Ptprq UTSW 10 107,444,225 (GRCm39) missense probably damaging 0.99
R4435:Ptprq UTSW 10 107,520,916 (GRCm39) missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107,521,043 (GRCm39) missense probably benign 0.19
R4679:Ptprq UTSW 10 107,521,043 (GRCm39) missense probably benign 0.19
R4745:Ptprq UTSW 10 107,360,114 (GRCm39) missense probably damaging 1.00
R4771:Ptprq UTSW 10 107,524,288 (GRCm39) missense probably benign
R4778:Ptprq UTSW 10 107,426,883 (GRCm39) missense probably benign 0.15
R4808:Ptprq UTSW 10 107,554,368 (GRCm39) missense probably damaging 1.00
R4809:Ptprq UTSW 10 107,399,036 (GRCm39) missense probably damaging 1.00
R4818:Ptprq UTSW 10 107,546,442 (GRCm39) missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107,489,393 (GRCm39) missense probably benign 0.00
R4901:Ptprq UTSW 10 107,524,275 (GRCm39) missense probably benign 0.01
R4942:Ptprq UTSW 10 107,524,290 (GRCm39) missense probably benign 0.01
R4946:Ptprq UTSW 10 107,361,595 (GRCm39) missense probably benign
R4959:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R4973:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R5007:Ptprq UTSW 10 107,444,137 (GRCm39) missense probably benign 0.00
R5053:Ptprq UTSW 10 107,399,063 (GRCm39) missense probably damaging 1.00
R5055:Ptprq UTSW 10 107,370,540 (GRCm39) missense probably benign 0.37
R5090:Ptprq UTSW 10 107,361,950 (GRCm39) missense probably damaging 1.00
R5158:Ptprq UTSW 10 107,370,565 (GRCm39) missense probably damaging 1.00
R5163:Ptprq UTSW 10 107,360,192 (GRCm39) missense probably damaging 1.00
R5222:Ptprq UTSW 10 107,498,425 (GRCm39) missense probably damaging 0.96
R5244:Ptprq UTSW 10 107,422,556 (GRCm39) missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107,535,496 (GRCm39) missense probably damaging 0.99
R5503:Ptprq UTSW 10 107,524,189 (GRCm39) splice site probably null
R5508:Ptprq UTSW 10 107,522,092 (GRCm39) missense probably benign 0.00
R5601:Ptprq UTSW 10 107,444,291 (GRCm39) missense probably benign
R5722:Ptprq UTSW 10 107,522,226 (GRCm39) missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107,555,744 (GRCm39) start gained probably benign
R5862:Ptprq UTSW 10 107,401,739 (GRCm39) missense probably benign 0.02
R5891:Ptprq UTSW 10 107,412,756 (GRCm39) missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107,359,374 (GRCm39) missense probably damaging 1.00
R6054:Ptprq UTSW 10 107,418,219 (GRCm39) missense probably damaging 1.00
R6058:Ptprq UTSW 10 107,471,135 (GRCm39) missense probably benign 0.00
R6075:Ptprq UTSW 10 107,361,621 (GRCm39) missense probably damaging 1.00
R6101:Ptprq UTSW 10 107,416,127 (GRCm39) missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107,353,748 (GRCm39) missense probably damaging 1.00
R6235:Ptprq UTSW 10 107,471,199 (GRCm39) missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107,544,529 (GRCm39) missense probably damaging 0.99
R6394:Ptprq UTSW 10 107,478,804 (GRCm39) nonsense probably null
R6449:Ptprq UTSW 10 107,541,444 (GRCm39) missense probably benign 0.00
R6526:Ptprq UTSW 10 107,378,514 (GRCm39) nonsense probably null
R6544:Ptprq UTSW 10 107,444,102 (GRCm39) missense probably damaging 1.00
R6609:Ptprq UTSW 10 107,408,829 (GRCm39) missense probably damaging 0.99
R6862:Ptprq UTSW 10 107,522,086 (GRCm39) missense probably damaging 0.96
R6874:Ptprq UTSW 10 107,554,460 (GRCm39) missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107,411,865 (GRCm39) missense probably benign 0.00
R7082:Ptprq UTSW 10 107,544,591 (GRCm39) missense probably benign 0.10
R7210:Ptprq UTSW 10 107,521,032 (GRCm39) missense probably damaging 1.00
R7253:Ptprq UTSW 10 107,444,134 (GRCm39) missense probably benign 0.30
R7293:Ptprq UTSW 10 107,471,367 (GRCm39) nonsense probably null
R7445:Ptprq UTSW 10 107,426,820 (GRCm39) missense probably damaging 1.00
R7685:Ptprq UTSW 10 107,479,839 (GRCm39) missense probably damaging 1.00
R7703:Ptprq UTSW 10 107,480,007 (GRCm39) missense probably benign 0.01
R7774:Ptprq UTSW 10 107,479,530 (GRCm39) missense probably damaging 0.96
R7897:Ptprq UTSW 10 107,546,484 (GRCm39) missense probably benign 0.21
R7936:Ptprq UTSW 10 107,488,572 (GRCm39) missense probably damaging 1.00
R7983:Ptprq UTSW 10 107,444,272 (GRCm39) nonsense probably null
R8023:Ptprq UTSW 10 107,488,477 (GRCm39) nonsense probably null
R8071:Ptprq UTSW 10 107,479,896 (GRCm39) missense possibly damaging 0.62
R8084:Ptprq UTSW 10 107,444,294 (GRCm39) missense probably benign
R8086:Ptprq UTSW 10 107,482,500 (GRCm39) nonsense probably null
R8169:Ptprq UTSW 10 107,418,351 (GRCm39) missense probably damaging 1.00
R8223:Ptprq UTSW 10 107,535,499 (GRCm39) missense probably benign 0.00
R8235:Ptprq UTSW 10 107,541,351 (GRCm39) missense probably benign 0.32
R8235:Ptprq UTSW 10 107,418,402 (GRCm39) missense probably damaging 1.00
R8278:Ptprq UTSW 10 107,522,239 (GRCm39) missense possibly damaging 0.87
R8710:Ptprq UTSW 10 107,411,919 (GRCm39) missense possibly damaging 0.67
R8828:Ptprq UTSW 10 107,482,513 (GRCm39) missense probably benign
R8830:Ptprq UTSW 10 107,422,556 (GRCm39) missense possibly damaging 0.62
R8869:Ptprq UTSW 10 107,535,469 (GRCm39) missense probably damaging 1.00
R9012:Ptprq UTSW 10 107,489,411 (GRCm39) missense probably benign 0.09
R9072:Ptprq UTSW 10 107,401,736 (GRCm39) missense
R9153:Ptprq UTSW 10 107,416,126 (GRCm39) missense probably damaging 0.98
R9202:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R9252:Ptprq UTSW 10 107,522,247 (GRCm39) missense probably benign 0.12
R9306:Ptprq UTSW 10 107,422,599 (GRCm39) missense probably benign 0.00
R9492:Ptprq UTSW 10 107,478,813 (GRCm39) missense probably damaging 1.00
R9519:Ptprq UTSW 10 107,520,961 (GRCm39) missense probably damaging 1.00
R9581:Ptprq UTSW 10 107,547,771 (GRCm39) missense possibly damaging 0.53
R9593:Ptprq UTSW 10 107,524,254 (GRCm39) missense possibly damaging 0.92
R9621:Ptprq UTSW 10 107,378,523 (GRCm39) missense probably damaging 1.00
R9732:Ptprq UTSW 10 107,412,767 (GRCm39) missense probably damaging 1.00
R9743:Ptprq UTSW 10 107,520,982 (GRCm39) missense probably damaging 1.00
R9771:Ptprq UTSW 10 107,521,085 (GRCm39) missense probably damaging 0.99
R9788:Ptprq UTSW 10 107,401,751 (GRCm39) missense probably benign 0.24
Z1088:Ptprq UTSW 10 107,535,533 (GRCm39) missense possibly damaging 0.56
Z1176:Ptprq UTSW 10 107,361,931 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTGAAATACAGTCATCTGC -3'
(R):5'- AGTTCATTTCGCAACAGGTGG -3'

Sequencing Primer
(F):5'- TGAAATACAGTCATCTGCACATAGC -3'
(R):5'- CGCAACAGGTGGAAATTTAAAATCC -3'
Posted On 2019-10-24