Incidental Mutation 'R7632:Ptprq'
ID 589709
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Name protein tyrosine phosphatase, receptor type, Q
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.220) question?
Stock # R7632 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 107517049-107720051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107711922 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 205 (V205A)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
AlphaFold P0C5E4
Predicted Effect probably benign
Transcript: ENSMUST00000050702
AA Change: V205A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: V205A

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,631,323 D924G probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
B3gnt8 A G 7: 25,628,435 I97V possibly damaging Het
Bach1 A G 16: 87,720,143 D524G probably benign Het
BC067074 C A 13: 113,320,886 S1155R Het
Caprin2 T C 6: 148,883,456 S107G probably damaging Het
Ccnb1 A G 13: 100,781,701 I207T probably benign Het
Cdh11 T C 8: 102,673,883 D151G probably damaging Het
Cdh9 A G 15: 16,851,029 probably null Het
Cep83 A T 10: 94,750,640 R433W probably damaging Het
D3Ertd751e A G 3: 41,753,728 E100G probably benign Het
Dchs2 C T 3: 83,348,050 A2351V probably benign Het
Dhx40 T C 11: 86,799,437 T253A probably benign Het
Dqx1 A G 6: 83,059,699 D228G probably benign Het
Dync1h1 T C 12: 110,660,893 M4002T probably benign Het
Flcn C T 11: 59,795,799 W376* probably null Het
Flnc A T 6: 29,446,985 Y1037F probably damaging Het
Fut11 T A 14: 20,695,028 V9E probably benign Het
Fv1 T A 4: 147,869,935 N319K possibly damaging Het
Ghrhr G T 6: 55,384,742 G298V probably benign Het
Gm5800 T A 14: 51,716,448 probably null Het
Grin2b A G 6: 135,732,555 M1331T probably benign Het
Hyou1 A G 9: 44,381,136 probably null Het
Igkv1-117 C A 6: 68,121,808 Q114K probably damaging Het
Igkv4-68 A G 6: 69,305,064 V41A possibly damaging Het
Inpp4b A G 8: 82,046,339 N754S probably damaging Het
Isl2 G A 9: 55,541,156 probably null Het
Kat2a G A 11: 100,708,596 Q523* probably null Het
Lypd3 T C 7: 24,638,440 F77S possibly damaging Het
Map4k2 T C 19: 6,344,054 L297P probably benign Het
Naca T C 10: 128,040,506 V469A unknown Het
Notch3 C T 17: 32,158,506 V199I probably benign Het
Olfr1294 T C 2: 111,538,176 I38V possibly damaging Het
Olfr1475 T C 19: 13,479,431 M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,597,968 probably null Het
Pcdhb8 A T 18: 37,355,595 I109L probably benign Het
Pde2a A G 7: 101,484,594 D104G possibly damaging Het
Phip A G 9: 82,903,190 V824A probably benign Het
Plekhg4 T C 8: 105,380,150 Y853H probably damaging Het
Plod1 T C 4: 147,927,024 K248R probably damaging Het
Plxnd1 A T 6: 115,976,639 Y656N probably benign Het
Pogz G A 3: 94,856,206 probably null Het
Ppp1r3e T A 14: 54,877,069 S79C probably damaging Het
Pprc1 T A 19: 46,072,282 D1595E probably damaging Het
Rad51ap2 T C 12: 11,457,115 V346A possibly damaging Het
Rgs12 T A 5: 34,965,590 L239H probably damaging Het
Rrp8 T C 7: 105,736,520 probably benign Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,579,906 probably benign Het
Scaf1 A T 7: 45,007,079 V792D unknown Het
Scrn2 G T 11: 97,033,142 R284L possibly damaging Het
Sgsm1 T A 5: 113,276,082 Q461L possibly damaging Het
Slc18b1 A G 10: 23,826,182 T434A probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Snx33 A T 9: 56,926,418 D122E probably damaging Het
Srebf2 G T 15: 82,185,296 V680L probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Tecpr1 C T 5: 144,218,726 V5M probably benign Het
Tfg A G 16: 56,712,634 V54A possibly damaging Het
Tmem237 C T 1: 59,116,901 C30Y probably benign Het
Tmem245 T C 4: 56,916,787 K444R probably benign Het
Trim25 T G 11: 89,015,776 L446R probably null Het
Usp37 T C 1: 74,468,374 T495A probably benign Het
Vmn1r94 T G 7: 20,167,771 T203P probably damaging Het
Ywhah T A 5: 33,026,666 M71K probably benign Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0200:Ptprq UTSW 10 107685157 missense probably benign
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1711:Ptprq UTSW 10 107534699 nonsense probably null
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2015:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3683:Ptprq UTSW 10 107708628 missense probably benign 0.01
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4745:Ptprq UTSW 10 107524253 missense probably damaging 1.00
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5222:Ptprq UTSW 10 107662564 missense probably damaging 0.96
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107708668 missense probably damaging 0.99
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
R7445:Ptprq UTSW 10 107590959 missense probably damaging 1.00
R7685:Ptprq UTSW 10 107643978 missense probably damaging 1.00
R7703:Ptprq UTSW 10 107644146 missense probably benign 0.01
R7774:Ptprq UTSW 10 107643669 missense probably damaging 0.96
R7897:Ptprq UTSW 10 107710623 missense probably benign 0.21
R7936:Ptprq UTSW 10 107652711 missense probably damaging 1.00
R7983:Ptprq UTSW 10 107608411 nonsense probably null
R8023:Ptprq UTSW 10 107652616 nonsense probably null
R8071:Ptprq UTSW 10 107644035 missense possibly damaging 0.62
R8084:Ptprq UTSW 10 107608433 missense probably benign
R8086:Ptprq UTSW 10 107646639 nonsense probably null
R8169:Ptprq UTSW 10 107582490 missense probably damaging 1.00
R8223:Ptprq UTSW 10 107699638 missense probably benign 0.00
R8235:Ptprq UTSW 10 107582541 missense probably damaging 1.00
R8235:Ptprq UTSW 10 107705490 missense probably benign 0.32
R8278:Ptprq UTSW 10 107686378 missense possibly damaging 0.87
R8710:Ptprq UTSW 10 107576058 missense possibly damaging 0.67
R8828:Ptprq UTSW 10 107646652 missense probably benign
R8830:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R8869:Ptprq UTSW 10 107699608 missense probably damaging 1.00
R9012:Ptprq UTSW 10 107653550 missense probably benign 0.09
R9072:Ptprq UTSW 10 107565875 missense
R9153:Ptprq UTSW 10 107580265 missense probably damaging 0.98
R9202:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R9252:Ptprq UTSW 10 107686386 missense probably benign 0.12
R9306:Ptprq UTSW 10 107586738 missense probably benign 0.00
R9492:Ptprq UTSW 10 107642952 missense probably damaging 1.00
R9519:Ptprq UTSW 10 107685100 missense probably damaging 1.00
R9581:Ptprq UTSW 10 107711910 missense possibly damaging 0.53
R9593:Ptprq UTSW 10 107688393 missense possibly damaging 0.92
R9621:Ptprq UTSW 10 107542662 missense probably damaging 1.00
R9732:Ptprq UTSW 10 107576906 missense probably damaging 1.00
R9743:Ptprq UTSW 10 107685121 missense probably damaging 1.00
R9771:Ptprq UTSW 10 107685224 missense probably damaging 0.99
R9788:Ptprq UTSW 10 107565890 missense probably benign 0.24
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Z1176:Ptprq UTSW 10 107526070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTGAAATACAGTCATCTGC -3'
(R):5'- AGTTCATTTCGCAACAGGTGG -3'

Sequencing Primer
(F):5'- TGAAATACAGTCATCTGCACATAGC -3'
(R):5'- CGCAACAGGTGGAAATTTAAAATCC -3'
Posted On 2019-10-24