Incidental Mutation 'R7632:Bach1'
ID 589725
Institutional Source Beutler Lab
Gene Symbol Bach1
Ensembl Gene ENSMUSG00000025612
Gene Name BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms 6230421P05Rik
MMRRC Submission 045720-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7632 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 87495842-87530234 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87517031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 524 (D524G)
Ref Sequence ENSEMBL: ENSMUSP00000026703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026703]
AlphaFold P97302
PDB Structure Structure of mouse Bach1 BTB domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026703
AA Change: D524G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026703
Gene: ENSMUSG00000025612
AA Change: D524G

DomainStartEndE-ValueType
BTB 34 130 1.23e-24 SMART
Blast:BTB 153 235 2e-29 BLAST
low complexity region 378 390 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
BRLZ 556 622 1.2e-12 SMART
low complexity region 699 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the cap'n'collar type of basic region leucine zipper factor family (CNC-bZip). The encoded protein contains broad complex, tramtrack, bric-a-brac/poxvirus and zinc finger (BTB/POZ) domains, which is atypical of CNC-bZip family members. These BTB/POZ domains facilitate protein-protein interactions and formation of homo- and/or hetero-oligomers. When this encoded protein forms a heterodimer with MafK, it functions as a repressor of Maf recognition element (MARE) and transcription is repressed. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mice are healthy and fertile with no gross abnormalities but express elevated levels of HMOX1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,211,236 (GRCm39) D924G probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atrnl1 A G 19: 57,618,738 (GRCm39) D152G probably damaging Het
B3gnt8 A G 7: 25,327,860 (GRCm39) I97V possibly damaging Het
Caprin2 T C 6: 148,784,954 (GRCm39) S107G probably damaging Het
Ccnb1 A G 13: 100,918,209 (GRCm39) I207T probably benign Het
Cdh11 T C 8: 103,400,515 (GRCm39) D151G probably damaging Het
Cdh9 A G 15: 16,851,115 (GRCm39) probably null Het
Cep83 A T 10: 94,586,502 (GRCm39) R433W probably damaging Het
Cspg4b C A 13: 113,457,420 (GRCm39) S1155R Het
D3Ertd751e A G 3: 41,708,163 (GRCm39) E100G probably benign Het
Dchs2 C T 3: 83,255,357 (GRCm39) A2351V probably benign Het
Dhx40 T C 11: 86,690,263 (GRCm39) T253A probably benign Het
Dqx1 A G 6: 83,036,680 (GRCm39) D228G probably benign Het
Dync1h1 T C 12: 110,627,327 (GRCm39) M4002T probably benign Het
Flcn C T 11: 59,686,625 (GRCm39) W376* probably null Het
Flnc A T 6: 29,446,984 (GRCm39) Y1037F probably damaging Het
Fut11 T A 14: 20,745,096 (GRCm39) V9E probably benign Het
Fv1 T A 4: 147,954,392 (GRCm39) N319K possibly damaging Het
Ghrhr G T 6: 55,361,727 (GRCm39) G298V probably benign Het
Gm5800 T A 14: 51,953,905 (GRCm39) probably null Het
Grin2b A G 6: 135,709,553 (GRCm39) M1331T probably benign Het
Hyou1 A G 9: 44,292,433 (GRCm39) probably null Het
Igkv1-117 C A 6: 68,098,792 (GRCm39) Q114K probably damaging Het
Igkv4-68 A G 6: 69,282,048 (GRCm39) V41A possibly damaging Het
Inpp4b A G 8: 82,772,968 (GRCm39) N754S probably damaging Het
Isl2 G A 9: 55,448,440 (GRCm39) probably null Het
Kat2a G A 11: 100,599,422 (GRCm39) Q523* probably null Het
Lypd3 T C 7: 24,337,865 (GRCm39) F77S possibly damaging Het
Map4k2 T C 19: 6,394,084 (GRCm39) L297P probably benign Het
Naca T C 10: 127,876,375 (GRCm39) V469A unknown Het
Notch3 C T 17: 32,377,480 (GRCm39) V199I probably benign Het
Or4k44 T C 2: 111,368,521 (GRCm39) I38V possibly damaging Het
Or5b119 T C 19: 13,456,795 (GRCm39) M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,598,212 (GRCm39) probably null Het
Pcdhb8 A T 18: 37,488,648 (GRCm39) I109L probably benign Het
Pde2a A G 7: 101,133,801 (GRCm39) D104G possibly damaging Het
Phip A G 9: 82,785,243 (GRCm39) V824A probably benign Het
Plekhg4 T C 8: 106,106,782 (GRCm39) Y853H probably damaging Het
Plod1 T C 4: 148,011,481 (GRCm39) K248R probably damaging Het
Plxnd1 A T 6: 115,953,600 (GRCm39) Y656N probably benign Het
Pogz G A 3: 94,763,517 (GRCm39) probably null Het
Ppp1r3e T A 14: 55,114,526 (GRCm39) S79C probably damaging Het
Pprc1 T A 19: 46,060,721 (GRCm39) D1595E probably damaging Het
Ptprq A G 10: 107,547,783 (GRCm39) V205A probably benign Het
Rad51ap2 T C 12: 11,507,116 (GRCm39) V346A possibly damaging Het
Rgs12 T A 5: 35,122,934 (GRCm39) L239H probably damaging Het
Rrp8 T C 7: 105,385,727 (GRCm39) probably benign Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Scaf1 A T 7: 44,656,503 (GRCm39) V792D unknown Het
Scrn2 G T 11: 96,923,968 (GRCm39) R284L possibly damaging Het
Sgsm1 T A 5: 113,423,948 (GRCm39) Q461L possibly damaging Het
Slc18b1 A G 10: 23,702,080 (GRCm39) T434A probably benign Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Snx33 A T 9: 56,833,702 (GRCm39) D122E probably damaging Het
Srebf2 G T 15: 82,069,497 (GRCm39) V680L probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Tecpr1 C T 5: 144,155,544 (GRCm39) V5M probably benign Het
Tfg A G 16: 56,532,997 (GRCm39) V54A possibly damaging Het
Tmem237 C T 1: 59,156,060 (GRCm39) C30Y probably benign Het
Tmem245 T C 4: 56,916,787 (GRCm39) K444R probably benign Het
Trim25 T G 11: 88,906,602 (GRCm39) L446R probably null Het
Usp37 T C 1: 74,507,533 (GRCm39) T495A probably benign Het
Vmn1r94 T G 7: 19,901,696 (GRCm39) T203P probably damaging Het
Ywhah T A 5: 33,184,010 (GRCm39) M71K probably benign Het
Other mutations in Bach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01553:Bach1 APN 16 87,519,393 (GRCm39) missense probably damaging 1.00
R0626:Bach1 UTSW 16 87,526,359 (GRCm39) missense possibly damaging 0.94
R0701:Bach1 UTSW 16 87,516,877 (GRCm39) missense probably damaging 0.99
R1070:Bach1 UTSW 16 87,517,009 (GRCm39) missense probably benign 0.02
R1160:Bach1 UTSW 16 87,512,322 (GRCm39) missense probably benign 0.34
R2066:Bach1 UTSW 16 87,526,513 (GRCm39) missense probably damaging 0.99
R2235:Bach1 UTSW 16 87,517,001 (GRCm39) missense probably damaging 1.00
R4716:Bach1 UTSW 16 87,512,267 (GRCm39) start gained probably benign
R4801:Bach1 UTSW 16 87,519,340 (GRCm39) missense probably damaging 0.99
R4802:Bach1 UTSW 16 87,519,340 (GRCm39) missense probably damaging 0.99
R4989:Bach1 UTSW 16 87,515,888 (GRCm39) missense possibly damaging 0.94
R5016:Bach1 UTSW 16 87,516,206 (GRCm39) missense possibly damaging 0.88
R5527:Bach1 UTSW 16 87,516,433 (GRCm39) missense probably benign 0.01
R5657:Bach1 UTSW 16 87,516,173 (GRCm39) missense probably benign 0.00
R6064:Bach1 UTSW 16 87,526,752 (GRCm39) missense probably damaging 1.00
R6384:Bach1 UTSW 16 87,516,745 (GRCm39) nonsense probably null
R7009:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7027:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7028:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7029:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7030:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7095:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7096:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7192:Bach1 UTSW 16 87,526,551 (GRCm39) missense possibly damaging 0.71
R7385:Bach1 UTSW 16 87,526,385 (GRCm39) missense probably damaging 0.99
R7571:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7572:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7623:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7714:Bach1 UTSW 16 87,515,736 (GRCm39) nonsense probably null
R7715:Bach1 UTSW 16 87,516,859 (GRCm39) missense possibly damaging 0.82
R7746:Bach1 UTSW 16 87,526,521 (GRCm39) missense probably benign 0.00
R7896:Bach1 UTSW 16 87,515,893 (GRCm39) missense possibly damaging 0.63
R8129:Bach1 UTSW 16 87,519,314 (GRCm39) missense possibly damaging 0.51
R8169:Bach1 UTSW 16 87,519,390 (GRCm39) missense possibly damaging 0.93
R8296:Bach1 UTSW 16 87,526,467 (GRCm39) missense probably damaging 1.00
R8300:Bach1 UTSW 16 87,515,996 (GRCm39) missense probably benign
R8388:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8389:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8391:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8480:Bach1 UTSW 16 87,516,163 (GRCm39) missense probably damaging 1.00
R8691:Bach1 UTSW 16 87,516,517 (GRCm39) missense probably benign
R8748:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8749:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8952:Bach1 UTSW 16 87,512,353 (GRCm39) missense probably damaging 0.99
R9255:Bach1 UTSW 16 87,519,401 (GRCm39) missense possibly damaging 0.93
R9283:Bach1 UTSW 16 87,516,211 (GRCm39) missense probably benign
R9433:Bach1 UTSW 16 87,516,603 (GRCm39) missense probably benign 0.01
R9434:Bach1 UTSW 16 87,516,603 (GRCm39) missense probably benign 0.01
R9440:Bach1 UTSW 16 87,516,603 (GRCm39) missense probably benign 0.01
R9487:Bach1 UTSW 16 87,526,733 (GRCm39) missense probably benign
R9501:Bach1 UTSW 16 87,515,999 (GRCm39) missense probably benign 0.00
R9557:Bach1 UTSW 16 87,516,603 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGCGGACTTTCACAACTC -3'
(R):5'- GTTACTCAAGCCTATGTTGTGTTC -3'

Sequencing Primer
(F):5'- GGACTTTCACAACTCTCAGTTCCG -3'
(R):5'- GTGTTCTCCCCCATGATTAATACAC -3'
Posted On 2019-10-24