Incidental Mutation 'R0055:Ucp1'
ID58973
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Nameuncoupling protein 1 (mitochondrial, proton carrier)
SynonymsSlc25a7
MMRRC Submission 038349-MU
Accession Numbers

Ncbi RefSeq: NM_009463.3; MGI: 98894

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0055 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83290352-83298452 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 83290604 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 8 (E8*)
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
Predicted Effect probably null
Transcript: ENSMUST00000034146
AA Change: E8*
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: E8*

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype Strain: 1857471
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,968,161 S108R probably damaging Het
2010300C02Rik A C 1: 37,624,256 S854A probably benign Het
2210016F16Rik T C 13: 58,384,166 D192G probably damaging Het
4921501E09Rik A T 17: 33,066,722 W369R probably damaging Het
A2ml1 T C 6: 128,570,094 probably benign Het
Atp6v1h A T 1: 5,084,454 T2S probably benign Het
Bcl11b G A 12: 107,965,777 P179S probably benign Het
Cacna1a C T 8: 84,580,058 probably benign Het
Ccdc146 C T 5: 21,297,006 probably null Het
Ccdc61 T C 7: 18,892,536 D128G probably damaging Het
Cd55 A G 1: 130,459,576 probably benign Het
Cdk7 C A 13: 100,719,304 E99* probably null Het
Cox8a A T 19: 7,217,509 S2T probably damaging Het
Dennd5a A G 7: 109,899,791 I955T possibly damaging Het
Dopey1 A C 9: 86,512,652 E602A probably benign Het
Ephx4 T C 5: 107,413,078 L32S probably damaging Het
Fbxo21 T A 5: 118,000,490 D493E probably benign Het
Frmd4b A T 6: 97,323,649 probably benign Het
Fzd1 A T 5: 4,756,037 M515K possibly damaging Het
Gli2 A G 1: 118,890,408 probably benign Het
Gm12887 T A 4: 121,616,469 K61N probably damaging Het
Grin2a A T 16: 9,669,807 V409D probably damaging Het
Grin2b T C 6: 135,923,203 I227V probably benign Het
Helz2 T G 2: 181,228,821 D2879A possibly damaging Het
Itpr2 T C 6: 146,323,133 N1453S probably benign Het
Itpr3 C A 17: 27,098,322 S817Y probably damaging Het
Lin7c T A 2: 109,896,453 probably benign Het
Ly75 T C 2: 60,321,918 E1097G probably benign Het
Mcm10 T C 2: 4,991,407 N882D probably damaging Het
Mettl13 A T 1: 162,546,181 L167Q probably damaging Het
Morn2 A T 17: 80,295,513 M1L probably benign Het
Mybph G T 1: 134,193,852 V88L probably damaging Het
Nefm T A 14: 68,121,199 probably benign Het
Nf1 A G 11: 79,471,551 E1497G probably damaging Het
Olfr1281 T A 2: 111,328,525 Y35* probably null Het
Olfr137 T C 17: 38,304,811 S217G possibly damaging Het
Olfr615 A G 7: 103,561,037 K187E probably damaging Het
Olfr670 T A 7: 104,960,496 T79S possibly damaging Het
Plcd3 C G 11: 103,077,585 W382S probably damaging Het
Plxna1 T A 6: 89,329,739 I1370F possibly damaging Het
Rarb G A 14: 16,509,066 R106C probably damaging Het
Rps6ka5 G A 12: 100,678,580 T37I probably damaging Het
Runx1 G T 16: 92,644,141 probably benign Het
Scube1 A G 15: 83,634,736 V301A probably damaging Het
Sema3a A T 5: 13,400,037 N27I possibly damaging Het
Slc15a3 G T 19: 10,843,042 E8* probably null Het
Slc22a5 T C 11: 53,891,206 S112G probably benign Het
Slc25a45 T C 19: 5,880,467 F3L probably damaging Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slfn10-ps A G 11: 83,030,300 noncoding transcript Het
Slit2 C A 5: 48,281,726 C1077* probably null Het
Spn A G 7: 127,136,322 F82L possibly damaging Het
Tbccd1 A G 16: 22,841,905 W54R probably damaging Het
Unc80 A T 1: 66,506,623 probably benign Het
Vsnl1 A T 12: 11,386,986 probably null Het
Zdhhc11 C T 13: 73,982,686 Q295* probably null Het
Zfp457 T A 13: 67,294,034 H63L probably damaging Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 83293948 missense probably damaging 1.00
R0050:Ucp1 UTSW 8 83294228 missense probably damaging 1.00
R0055:Ucp1 UTSW 8 83290604 nonsense probably null
R0505:Ucp1 UTSW 8 83295307 missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 83291603 splice site probably benign
R0681:Ucp1 UTSW 8 83295307 missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 83297847 splice site probably benign
R1606:Ucp1 UTSW 8 83295304 missense probably damaging 1.00
R1722:Ucp1 UTSW 8 83290688 missense probably benign 0.25
R1809:Ucp1 UTSW 8 83297867 missense probably damaging 0.99
R1823:Ucp1 UTSW 8 83294032 missense probably damaging 1.00
R3809:Ucp1 UTSW 8 83290641 missense probably damaging 0.99
R4085:Ucp1 UTSW 8 83293951 missense probably benign 0.43
R4673:Ucp1 UTSW 8 83295247 missense probably damaging 1.00
R4998:Ucp1 UTSW 8 83297855 critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 83294203 missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 83290691 missense probably benign 0.12
R5790:Ucp1 UTSW 8 83297891 missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 83293938 missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 83294089 critical splice donor site probably null
R6732:Ucp1 UTSW 8 83291477 missense probably benign 0.08
R7282:Ucp1 UTSW 8 83293902 missense probably benign 0.03
R7343:Ucp1 UTSW 8 83295252 missense probably damaging 0.99
R7878:Ucp1 UTSW 8 83297892 missense probably benign 0.19
R7961:Ucp1 UTSW 8 83297892 missense probably benign 0.19
R8008:Ucp1 UTSW 8 83294011 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AAGAGGAAGGGACGCTCACCTTTG -3'
(R):5'- ACCCATCAACAGCGGTTCTTCAG -3'

Sequencing Primer
(F):5'- GACGCTCACCTTTGAGCTG -3'
(R):5'- GGTTCTTCAGCCAATCCAAGG -3'
Posted On2013-07-11