Incidental Mutation 'R7632:Sry'
ID 589732
Institutional Source Beutler Lab
Gene Symbol Sry
Ensembl Gene ENSMUSG00000069036
Gene Name sex determining region of Chr Y
Synonyms Tdy, Tdf
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R7632 (G1)
Quality Score 159.457
Status Not validated
Chromosome Y
Chromosomal Location 2662471-2663658 bp(-) (GRCm38)
Type of Mutation small deletion (10 aa in frame mutation)
DNA Base Change (assembly) GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG at 2662638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091178]
AlphaFold Q05738
Predicted Effect probably benign
Transcript: ENSMUST00000091178
SMART Domains Protein: ENSMUSP00000088717
Gene: ENSMUSG00000069036

DomainStartEndE-ValueType
HMG 4 74 2.76e-24 SMART
low complexity region 144 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
MGI Phenotype PHENOTYPE: Variations in expression of alleles on specific backgrounds result in partial and/or complete male to female sex reversal. Deletion of alleles results in XY females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,631,323 D924G probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
B3gnt8 A G 7: 25,628,435 I97V possibly damaging Het
Bach1 A G 16: 87,720,143 D524G probably benign Het
BC067074 C A 13: 113,320,886 S1155R Het
Caprin2 T C 6: 148,883,456 S107G probably damaging Het
Ccnb1 A G 13: 100,781,701 I207T probably benign Het
Cdh11 T C 8: 102,673,883 D151G probably damaging Het
Cdh9 A G 15: 16,851,029 probably null Het
Cep83 A T 10: 94,750,640 R433W probably damaging Het
D3Ertd751e A G 3: 41,753,728 E100G probably benign Het
Dchs2 C T 3: 83,348,050 A2351V probably benign Het
Dhx40 T C 11: 86,799,437 T253A probably benign Het
Dqx1 A G 6: 83,059,699 D228G probably benign Het
Dync1h1 T C 12: 110,660,893 M4002T probably benign Het
Flcn C T 11: 59,795,799 W376* probably null Het
Flnc A T 6: 29,446,985 Y1037F probably damaging Het
Fut11 T A 14: 20,695,028 V9E probably benign Het
Fv1 T A 4: 147,869,935 N319K possibly damaging Het
Ghrhr G T 6: 55,384,742 G298V probably benign Het
Gm5800 T A 14: 51,716,448 probably null Het
Grin2b A G 6: 135,732,555 M1331T probably benign Het
Hyou1 A G 9: 44,381,136 probably null Het
Igkv1-117 C A 6: 68,121,808 Q114K probably damaging Het
Igkv4-68 A G 6: 69,305,064 V41A possibly damaging Het
Inpp4b A G 8: 82,046,339 N754S probably damaging Het
Isl2 G A 9: 55,541,156 probably null Het
Kat2a G A 11: 100,708,596 Q523* probably null Het
Lypd3 T C 7: 24,638,440 F77S possibly damaging Het
Map4k2 T C 19: 6,344,054 L297P probably benign Het
Naca T C 10: 128,040,506 V469A unknown Het
Notch3 C T 17: 32,158,506 V199I probably benign Het
Olfr1294 T C 2: 111,538,176 I38V possibly damaging Het
Olfr1475 T C 19: 13,479,431 M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,597,968 probably null Het
Pcdhb8 A T 18: 37,355,595 I109L probably benign Het
Pde2a A G 7: 101,484,594 D104G possibly damaging Het
Phip A G 9: 82,903,190 V824A probably benign Het
Plekhg4 T C 8: 105,380,150 Y853H probably damaging Het
Plod1 T C 4: 147,927,024 K248R probably damaging Het
Plxnd1 A T 6: 115,976,639 Y656N probably benign Het
Pogz G A 3: 94,856,206 probably null Het
Ppp1r3e T A 14: 54,877,069 S79C probably damaging Het
Pprc1 T A 19: 46,072,282 D1595E probably damaging Het
Ptprq A G 10: 107,711,922 V205A probably benign Het
Rad51ap2 T C 12: 11,457,115 V346A possibly damaging Het
Rgs12 T A 5: 34,965,590 L239H probably damaging Het
Rrp8 T C 7: 105,736,520 probably benign Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,579,906 probably benign Het
Scaf1 A T 7: 45,007,079 V792D unknown Het
Scrn2 G T 11: 97,033,142 R284L possibly damaging Het
Sgsm1 T A 5: 113,276,082 Q461L possibly damaging Het
Slc18b1 A G 10: 23,826,182 T434A probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Snx33 A T 9: 56,926,418 D122E probably damaging Het
Srebf2 G T 15: 82,185,296 V680L probably benign Het
Tecpr1 C T 5: 144,218,726 V5M probably benign Het
Tfg A G 16: 56,712,634 V54A possibly damaging Het
Tmem237 C T 1: 59,116,901 C30Y probably benign Het
Tmem245 T C 4: 56,916,787 K444R probably benign Het
Trim25 T G 11: 89,015,776 L446R probably null Het
Usp37 T C 1: 74,468,374 T495A probably benign Het
Vmn1r94 T G 7: 20,167,771 T203P probably damaging Het
Ywhah T A 5: 33,026,666 M71K probably benign Het
Other mutations in Sry
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Sry UTSW Y 2662837 small insertion probably benign
FR4340:Sry UTSW Y 2662824 small insertion probably benign
FR4342:Sry UTSW Y 2662835 small insertion probably benign
FR4342:Sry UTSW Y 2662836 small insertion probably benign
FR4342:Sry UTSW Y 2662839 small insertion probably benign
FR4342:Sry UTSW Y 2663146 small deletion probably benign
FR4449:Sry UTSW Y 2662818 small insertion probably benign
FR4449:Sry UTSW Y 2662832 small insertion probably benign
FR4589:Sry UTSW Y 2662818 small insertion probably benign
FR4737:Sry UTSW Y 2662837 small insertion probably benign
FR4737:Sry UTSW Y 2662838 small insertion probably benign
FR4737:Sry UTSW Y 2663195 small deletion probably benign
FR4976:Sry UTSW Y 2662841 small insertion probably benign
R0288:Sry UTSW Y 2662818 missense unknown
R0506:Sry UTSW Y 2662864 missense unknown
R0690:Sry UTSW Y 2662944 small deletion probably benign
R0784:Sry UTSW Y 2662731 missense unknown
R1373:Sry UTSW Y 2662864 missense unknown
R1555:Sry UTSW Y 2662975 missense unknown
R1638:Sry UTSW Y 2663149 missense unknown
R2110:Sry UTSW Y 2662901 missense unknown
R2212:Sry UTSW Y 2663339 missense probably damaging 0.99
R3150:Sry UTSW Y 2662944 small deletion probably benign
R3552:Sry UTSW Y 2663141 missense unknown
R4877:Sry UTSW Y 2662864 missense unknown
R4888:Sry UTSW Y 2663105 missense unknown
R5028:Sry UTSW Y 2663312 missense probably damaging 0.97
R5266:Sry UTSW Y 2662975 missense unknown
R5305:Sry UTSW Y 2662982 missense unknown
R5335:Sry UTSW Y 2663647 missense probably benign 0.08
R5587:Sry UTSW Y 2662625 missense unknown
R5915:Sry UTSW Y 2662612 missense unknown
R6183:Sry UTSW Y 2662975 missense unknown
R6184:Sry UTSW Y 2662975 missense unknown
R6187:Sry UTSW Y 2662975 missense unknown
R6976:Sry UTSW Y 2662938 missense unknown
R7358:Sry UTSW Y 2662638 small deletion probably benign
R7678:Sry UTSW Y 2663248 missense possibly damaging 0.83
R7737:Sry UTSW Y 2662638 small deletion probably benign
R7812:Sry UTSW Y 2662638 small deletion probably benign
R7829:Sry UTSW Y 2662638 small deletion probably benign
R8005:Sry UTSW Y 2663303 missense possibly damaging 0.88
R8028:Sry UTSW Y 2662638 small deletion probably benign
R8082:Sry UTSW Y 2662589 missense unknown
R8212:Sry UTSW Y 2662638 small deletion probably benign
R8223:Sry UTSW Y 2663204 missense unknown
R8252:Sry UTSW Y 2663298 missense possibly damaging 0.91
R8390:Sry UTSW Y 2662638 small deletion probably benign
R9027:Sry UTSW Y 2662638 small deletion probably benign
R9429:Sry UTSW Y 2662638 small deletion probably benign
RF002:Sry UTSW Y 2662564 small deletion probably benign
RF006:Sry UTSW Y 2662638 small deletion probably benign
RF008:Sry UTSW Y 2662826 small insertion probably benign
RF040:Sry UTSW Y 2662590 small insertion probably benign
RF063:Sry UTSW Y 2662595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTCATGAGACTGCCAACCAC -3'
(R):5'- AGCCTGTTGATATCCCCACTGG -3'

Sequencing Primer
(F):5'- ACAGGGCTGTGCTGAGG -3'
(R):5'- GCAGCAGCATCAGTTCCATG -3'
Posted On 2019-10-24