Incidental Mutation 'R7633:Tyw5'
ID589733
Institutional Source Beutler Lab
Gene Symbol Tyw5
Ensembl Gene ENSMUSG00000048495
Gene NametRNA-yW synthesizing protein 5
Synonyms1110034B05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location57388237-57407101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57393485 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 117 (D117E)
Ref Sequence ENSEMBL: ENSMUSP00000125427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
Predicted Effect probably benign
Transcript: ENSMUST00000079998
AA Change: M111K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495
AA Change: M111K

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160118
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160837
AA Change: D113E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495
AA Change: D113E

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162686
AA Change: D117E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495
AA Change: D117E

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Tyw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Tyw5 APN 1 57388553 nonsense probably null
IGL01565:Tyw5 APN 1 57394081 missense probably damaging 1.00
IGL01675:Tyw5 APN 1 57388632 missense possibly damaging 0.94
IGL01915:Tyw5 APN 1 57401469 missense probably damaging 0.99
IGL02320:Tyw5 APN 1 57396725 critical splice donor site probably null
IGL02427:Tyw5 APN 1 57388725 missense possibly damaging 0.68
PIT4520001:Tyw5 UTSW 1 57388515 missense probably damaging 1.00
R0053:Tyw5 UTSW 1 57401438 missense probably damaging 0.97
R0053:Tyw5 UTSW 1 57401438 missense probably damaging 0.97
R2421:Tyw5 UTSW 1 57396748 missense possibly damaging 0.58
R2422:Tyw5 UTSW 1 57396748 missense possibly damaging 0.58
R2997:Tyw5 UTSW 1 57388641 missense probably damaging 1.00
R3974:Tyw5 UTSW 1 57391528 missense probably damaging 1.00
R4235:Tyw5 UTSW 1 57388488 utr 3 prime probably benign
R4630:Tyw5 UTSW 1 57388527 missense probably damaging 0.96
R5014:Tyw5 UTSW 1 57406845 start gained probably benign
R5099:Tyw5 UTSW 1 57388705 missense probably damaging 0.99
R5162:Tyw5 UTSW 1 57401459 missense probably damaging 1.00
R6389:Tyw5 UTSW 1 57391499 missense probably damaging 1.00
R6422:Tyw5 UTSW 1 57401411 missense probably damaging 0.99
R6524:Tyw5 UTSW 1 57388731 missense possibly damaging 0.67
R6908:Tyw5 UTSW 1 57401523 missense probably damaging 1.00
R7997:Tyw5 UTSW 1 57388524 missense probably benign 0.03
X0018:Tyw5 UTSW 1 57390663 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCAACAGCCTTCTGAACC -3'
(R):5'- TGCTGACAGTAGGAAGAACTCC -3'

Sequencing Primer
(F):5'- GAGCAACAGCCTTCTGAACCTTTAC -3'
(R):5'- CACTGGGAAGGTTGGGTGC -3'
Posted On2019-10-24