Incidental Mutation 'R7633:Tyw5'
ID 589733
Institutional Source Beutler Lab
Gene Symbol Tyw5
Ensembl Gene ENSMUSG00000048495
Gene Name tRNA-yW synthesizing protein 5
Synonyms 1110034B05Rik
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 57427394-57445833 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57432644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 117 (D117E)
Ref Sequence ENSEMBL: ENSMUSP00000125427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
AlphaFold A2RSX7
Predicted Effect probably benign
Transcript: ENSMUST00000079998
AA Change: M111K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495
AA Change: M111K

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160118
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160837
AA Change: D113E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495
AA Change: D113E

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162686
AA Change: D117E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495
AA Change: D117E

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Fam117b A G 1: 60,020,693 (GRCm39) D521G probably damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hgs A T 11: 120,365,128 (GRCm39) Q172L probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Mrgprb1 A G 7: 48,097,331 (GRCm39) F194L probably benign Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Or8s5 A G 15: 98,237,967 (GRCm39) I301T probably damaging Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Ppfia1 T C 7: 144,106,173 (GRCm39) D33G possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Qrich2 A T 11: 116,347,455 (GRCm39) I1123K unknown Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Synpo G A 18: 60,736,500 (GRCm39) T482I probably damaging Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Tyw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Tyw5 APN 1 57,427,712 (GRCm39) nonsense probably null
IGL01565:Tyw5 APN 1 57,433,240 (GRCm39) missense probably damaging 1.00
IGL01675:Tyw5 APN 1 57,427,791 (GRCm39) missense possibly damaging 0.94
IGL01915:Tyw5 APN 1 57,440,628 (GRCm39) missense probably damaging 0.99
IGL02320:Tyw5 APN 1 57,435,884 (GRCm39) critical splice donor site probably null
IGL02427:Tyw5 APN 1 57,427,884 (GRCm39) missense possibly damaging 0.68
PIT4520001:Tyw5 UTSW 1 57,427,674 (GRCm39) missense probably damaging 1.00
R0053:Tyw5 UTSW 1 57,440,597 (GRCm39) missense probably damaging 0.97
R0053:Tyw5 UTSW 1 57,440,597 (GRCm39) missense probably damaging 0.97
R2421:Tyw5 UTSW 1 57,435,907 (GRCm39) missense possibly damaging 0.58
R2422:Tyw5 UTSW 1 57,435,907 (GRCm39) missense possibly damaging 0.58
R2997:Tyw5 UTSW 1 57,427,800 (GRCm39) missense probably damaging 1.00
R3974:Tyw5 UTSW 1 57,430,687 (GRCm39) missense probably damaging 1.00
R4235:Tyw5 UTSW 1 57,427,647 (GRCm39) utr 3 prime probably benign
R4630:Tyw5 UTSW 1 57,427,686 (GRCm39) missense probably damaging 0.96
R5014:Tyw5 UTSW 1 57,446,004 (GRCm39) start gained probably benign
R5099:Tyw5 UTSW 1 57,427,864 (GRCm39) missense probably damaging 0.99
R5162:Tyw5 UTSW 1 57,440,618 (GRCm39) missense probably damaging 1.00
R6389:Tyw5 UTSW 1 57,430,658 (GRCm39) missense probably damaging 1.00
R6422:Tyw5 UTSW 1 57,440,570 (GRCm39) missense probably damaging 0.99
R6524:Tyw5 UTSW 1 57,427,890 (GRCm39) missense possibly damaging 0.67
R6908:Tyw5 UTSW 1 57,440,682 (GRCm39) missense probably damaging 1.00
R7997:Tyw5 UTSW 1 57,427,683 (GRCm39) missense probably benign 0.03
R9218:Tyw5 UTSW 1 57,435,948 (GRCm39) missense probably damaging 0.97
X0018:Tyw5 UTSW 1 57,429,822 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCAACAGCCTTCTGAACC -3'
(R):5'- TGCTGACAGTAGGAAGAACTCC -3'

Sequencing Primer
(F):5'- GAGCAACAGCCTTCTGAACCTTTAC -3'
(R):5'- CACTGGGAAGGTTGGGTGC -3'
Posted On 2019-10-24