Incidental Mutation 'R7633:Fam117b'
ID 589734
Institutional Source Beutler Lab
Gene Symbol Fam117b
Ensembl Gene ENSMUSG00000041040
Gene Name family with sequence similarity 117, member B
Synonyms 2810425F24Rik, Als2cr13, 6330416D14Rik
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 59952165-60024505 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60020693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 521 (D521G)
Ref Sequence ENSEMBL: ENSMUSP00000041671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036540]
AlphaFold Q3U3E2
Predicted Effect probably damaging
Transcript: ENSMUST00000036540
AA Change: D521G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041671
Gene: ENSMUSG00000041040
AA Change: D521G

DomainStartEndE-ValueType
low complexity region 9 29 N/A INTRINSIC
low complexity region 50 104 N/A INTRINSIC
low complexity region 114 144 N/A INTRINSIC
Pfam:FAM117 211 524 2.9e-125 PFAM
low complexity region 531 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hgs A T 11: 120,365,128 (GRCm39) Q172L probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Mrgprb1 A G 7: 48,097,331 (GRCm39) F194L probably benign Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Or8s5 A G 15: 98,237,967 (GRCm39) I301T probably damaging Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Ppfia1 T C 7: 144,106,173 (GRCm39) D33G possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Qrich2 A T 11: 116,347,455 (GRCm39) I1123K unknown Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Synpo G A 18: 60,736,500 (GRCm39) T482I probably damaging Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Tyw5 A T 1: 57,432,644 (GRCm39) D117E probably benign Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Fam117b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Fam117b APN 1 60,008,177 (GRCm39) missense probably damaging 0.99
IGL01596:Fam117b APN 1 59,992,130 (GRCm39) nonsense probably null
IGL02104:Fam117b APN 1 59,988,278 (GRCm39) missense probably benign 0.36
IGL02129:Fam117b APN 1 60,020,582 (GRCm39) missense probably benign 0.07
IGL03387:Fam117b APN 1 59,992,119 (GRCm39) missense probably benign 0.26
R0690:Fam117b UTSW 1 59,997,512 (GRCm39) missense possibly damaging 0.65
R1074:Fam117b UTSW 1 59,997,485 (GRCm39) missense possibly damaging 0.88
R1435:Fam117b UTSW 1 60,008,222 (GRCm39) missense possibly damaging 0.80
R2215:Fam117b UTSW 1 60,008,219 (GRCm39) missense probably damaging 1.00
R2267:Fam117b UTSW 1 59,952,789 (GRCm39) missense probably damaging 1.00
R2268:Fam117b UTSW 1 59,952,789 (GRCm39) missense probably damaging 1.00
R5765:Fam117b UTSW 1 60,009,631 (GRCm39) splice site probably null
R6228:Fam117b UTSW 1 60,008,207 (GRCm39) missense probably damaging 1.00
R6439:Fam117b UTSW 1 60,020,731 (GRCm39) missense probably benign 0.45
R6921:Fam117b UTSW 1 59,992,094 (GRCm39) missense probably damaging 1.00
R7827:Fam117b UTSW 1 59,952,837 (GRCm39) missense possibly damaging 0.94
R7867:Fam117b UTSW 1 60,014,046 (GRCm39) missense probably damaging 0.98
R8305:Fam117b UTSW 1 59,952,782 (GRCm39) missense probably benign 0.18
R9116:Fam117b UTSW 1 60,018,456 (GRCm39) nonsense probably null
R9368:Fam117b UTSW 1 60,020,740 (GRCm39) missense probably benign 0.12
X0004:Fam117b UTSW 1 60,014,137 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTTGGCATTTCTGACAGATTC -3'
(R):5'- GCTTCCTCAATGGGTTCTGG -3'

Sequencing Primer
(F):5'- GCCTTTTACTGTCCTGACA -3'
(R):5'- CCTCAATGGGTTCTGGTGGTG -3'
Posted On 2019-10-24