Incidental Mutation 'R7633:Degs1'
ID 589737
Institutional Source Beutler Lab
Gene Symbol Degs1
Ensembl Gene ENSMUSG00000038633
Gene Name delta(4)-desaturase, sphingolipid 1
Synonyms Mdes, Des1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 182275772-182282804 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 182279698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 35 (S35P)
Ref Sequence ENSEMBL: ENSMUSP00000048519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035295] [ENSMUST00000133052]
AlphaFold O09005
Predicted Effect probably damaging
Transcript: ENSMUST00000035295
AA Change: S35P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048519
Gene: ENSMUSG00000038633
AA Change: S35P

DomainStartEndE-ValueType
Lipid_DES 5 43 4.36e-20 SMART
Pfam:FA_desaturase 65 293 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133052
SMART Domains Protein: ENSMUSP00000119473
Gene: ENSMUSG00000038633

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
transmembrane domain 37 55 N/A INTRINSIC
Pfam:FA_desaturase 59 260 4.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane fatty acid desaturase family which is responsible for inserting double bonds into specific positions in fatty acids. This protein contains three His-containing consensus motifs that are characteristic of a group of membrane fatty acid desaturases. It is predicted to be a multiple membrane-spanning protein localized to the endoplasmic reticulum. Overexpression of this gene inhibited biosynthesis of the EGF receptor, suggesting a possible role of a fatty acid desaturase in regulating biosynthetic processing of the EGF receptor. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased to absent ceramide levels, decreased body weight, scaly skin, sparse hair, tremors, hematological and blood chemistry abnormalities, decreased bone mineral content and density and decreased liver function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Degs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Degs1 APN 1 182279209 missense probably benign 0.34
IGL01766:Degs1 APN 1 182279095 missense probably damaging 1.00
IGL02237:Degs1 APN 1 182279688 missense probably damaging 0.97
IGL02578:Degs1 APN 1 182279027 nonsense probably null
IGL03200:Degs1 APN 1 182279691 start codon destroyed probably null 1.00
R0087:Degs1 UTSW 1 182279310 missense probably benign 0.00
R0126:Degs1 UTSW 1 182279692 start codon destroyed probably null 0.85
R0299:Degs1 UTSW 1 182279271 missense probably damaging 0.99
R4157:Degs1 UTSW 1 182282627 missense possibly damaging 0.83
R4260:Degs1 UTSW 1 182279241 missense probably benign
R4520:Degs1 UTSW 1 182276808 missense possibly damaging 0.95
R4606:Degs1 UTSW 1 182276823 missense probably damaging 0.99
R4888:Degs1 UTSW 1 182276805 missense probably damaging 0.98
R5366:Degs1 UTSW 1 182279362 missense probably benign 0.08
R6574:Degs1 UTSW 1 182279073 missense probably damaging 1.00
R7023:Degs1 UTSW 1 182279065 missense probably damaging 0.99
R7164:Degs1 UTSW 1 182279125 missense probably damaging 0.99
R7894:Degs1 UTSW 1 182276851 missense probably damaging 0.97
R7894:Degs1 UTSW 1 182276852 missense probably benign 0.00
R7905:Degs1 UTSW 1 182279036 missense possibly damaging 0.72
R8233:Degs1 UTSW 1 182279595 missense probably benign 0.36
R8296:Degs1 UTSW 1 182282676 missense probably benign 0.43
R8974:Degs1 UTSW 1 182279713 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACATTCCAAACCAGCGGTTC -3'
(R):5'- AATATCTCATAAAGTCTGTCAGGGG -3'

Sequencing Primer
(F):5'- AAACCAGCGGTTCCACAGGG -3'
(R):5'- TCTGTCAGGGGGAGAATTATAAC -3'
Posted On 2019-10-24