Incidental Mutation 'R7633:Ehmt1'
ID589739
Institutional Source Beutler Lab
Gene Symbol Ehmt1
Ensembl Gene ENSMUSG00000036893
Gene Nameeuchromatic histone methyltransferase 1
SynonymsKMT1D, 9230102N17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24789928-24919614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24815780 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 851 (D851G)
Ref Sequence ENSEMBL: ENSMUSP00000119057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046227] [ENSMUST00000091348] [ENSMUST00000102938] [ENSMUST00000114418] [ENSMUST00000114432] [ENSMUST00000147147] [ENSMUST00000152636]
Predicted Effect probably benign
Transcript: ENSMUST00000046227
AA Change: D803G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000046077
Gene: ENSMUSG00000036893
AA Change: D803G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091348
AA Change: D843G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088906
Gene: ENSMUSG00000036893
AA Change: D843G

DomainStartEndE-ValueType
low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 763 792 2.02e-5 SMART
ANK 796 827 3.06e-5 SMART
ANK 829 859 1.69e-7 SMART
ANK 863 892 6.65e-6 SMART
ANK 896 925 7.71e-2 SMART
ANK 929 958 6.12e-5 SMART
ANK 962 995 7.29e2 SMART
PreSET 1002 1101 1.05e-30 SMART
SET 1117 1240 2.24e-43 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102938
AA Change: D844G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100002
Gene: ENSMUSG00000036893
AA Change: D844G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 770 799 2.02e-5 SMART
ANK 803 834 3.06e-5 SMART
ANK 836 866 1.69e-7 SMART
ANK 870 899 6.65e-6 SMART
ANK 903 932 7.71e-2 SMART
ANK 936 965 6.12e-5 SMART
ANK 969 1002 7.29e2 SMART
PreSET 1009 1108 1.05e-30 SMART
SET 1124 1247 2.24e-43 SMART
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114418
AA Change: D803G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110061
Gene: ENSMUSG00000036893
AA Change: D803G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114432
AA Change: D798G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110075
Gene: ENSMUSG00000036893
AA Change: D798G

DomainStartEndE-ValueType
low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 717 746 2.02e-5 SMART
ANK 750 781 3.06e-5 SMART
ANK 783 813 1.69e-7 SMART
ANK 817 846 6.65e-6 SMART
ANK 850 879 7.71e-2 SMART
ANK 883 912 6.12e-5 SMART
ANK 916 949 7.29e2 SMART
PreSET 956 1055 1.05e-30 SMART
SET 1071 1194 2.24e-43 SMART
low complexity region 1211 1224 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147147
AA Change: D851G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119057
Gene: ENSMUSG00000036893
AA Change: D851G

DomainStartEndE-ValueType
low complexity region 252 271 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 352 364 N/A INTRINSIC
ANK 634 663 2.02e-5 SMART
ANK 667 698 3.06e-5 SMART
ANK 700 730 1.69e-7 SMART
ANK 734 763 6.65e-6 SMART
ANK 767 796 7.71e-2 SMART
ANK 800 829 6.12e-5 SMART
ANK 833 866 7.29e2 SMART
PreSET 873 972 1.05e-30 SMART
SET 988 1111 2.24e-43 SMART
low complexity region 1128 1141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152636
AA Change: *204W
SMART Domains Protein: ENSMUSP00000141460
Gene: ENSMUSG00000036893
AA Change: *204W

DomainStartEndE-ValueType
ANK 118 147 1.3e-7 SMART
ANK 151 182 2e-7 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that is part of the E2F6 complex, which represses transcription. The encoded protein methylates the Lys-9 position of histone H3, which tags it for transcriptional repression. This protein may be involved in the silencing of MYC- and E2F-responsive genes and therefore could play a role in the G0/G1 cell cycle transition. Defects in this gene are a cause of chromosome 9q subtelomeric deletion syndrome (9q-syndrome, also known as Kleefstra syndrome). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Nullizygous embryos die circa E9.5 showing delayed growth and incomplete somite formation and neural groove closure. Heterozygotes show behavioral deficits and synaptic dysfunction. Homozygotes with a H3K9me1-binding mutant form show delayed prenatal growth and bone ossification and postnatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Ehmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ehmt1 APN 2 24838818 missense possibly damaging 0.81
IGL01403:Ehmt1 APN 2 24839626 missense possibly damaging 0.81
IGL01636:Ehmt1 APN 2 24839608 missense probably damaging 0.97
IGL01804:Ehmt1 APN 2 24791954 missense probably damaging 1.00
IGL01836:Ehmt1 APN 2 24863220 splice site probably null
IGL02740:Ehmt1 APN 2 24815839 splice site probably benign
IGL02750:Ehmt1 APN 2 24863869 missense probably damaging 1.00
IGL03026:Ehmt1 APN 2 24852734 missense probably benign
IGL02799:Ehmt1 UTSW 2 24815806 missense probably damaging 1.00
R0908:Ehmt1 UTSW 2 24804888 missense probably damaging 1.00
R1275:Ehmt1 UTSW 2 24886995 critical splice donor site probably null
R1665:Ehmt1 UTSW 2 24877464 missense probably damaging 1.00
R1707:Ehmt1 UTSW 2 24805138 missense probably benign
R1800:Ehmt1 UTSW 2 24884290 missense probably damaging 0.99
R2108:Ehmt1 UTSW 2 24837618 missense probably damaging 1.00
R2113:Ehmt1 UTSW 2 24804003 missense probably damaging 1.00
R2393:Ehmt1 UTSW 2 24806217 missense probably damaging 1.00
R2570:Ehmt1 UTSW 2 24815741 missense probably damaging 1.00
R3923:Ehmt1 UTSW 2 24884335 synonymous probably null
R4646:Ehmt1 UTSW 2 24891684 missense probably null 0.01
R4924:Ehmt1 UTSW 2 24839722 missense probably damaging 0.97
R4989:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5040:Ehmt1 UTSW 2 24884304 missense probably benign 0.19
R5110:Ehmt1 UTSW 2 24852790 missense probably benign 0.01
R5133:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5134:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5161:Ehmt1 UTSW 2 24858195 missense possibly damaging 0.71
R5162:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5183:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5184:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5208:Ehmt1 UTSW 2 24801533 missense probably benign 0.34
R5309:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5312:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5837:Ehmt1 UTSW 2 24863914 missense probably damaging 0.98
R5968:Ehmt1 UTSW 2 24836457 missense probably damaging 0.99
R6539:Ehmt1 UTSW 2 24804767 missense probably damaging 1.00
R6646:Ehmt1 UTSW 2 24806310 missense probably damaging 0.99
R7065:Ehmt1 UTSW 2 24840697 missense probably damaging 1.00
R7226:Ehmt1 UTSW 2 24804782 missense probably damaging 1.00
R7361:Ehmt1 UTSW 2 24856701 missense possibly damaging 0.94
R7373:Ehmt1 UTSW 2 24919573 start codon destroyed probably null 0.03
R7410:Ehmt1 UTSW 2 24848068 missense probably benign
R7418:Ehmt1 UTSW 2 24884634 missense probably benign 0.02
R7716:Ehmt1 UTSW 2 24884499 missense probably damaging 0.99
R8112:Ehmt1 UTSW 2 24863384 missense probably damaging 1.00
X0062:Ehmt1 UTSW 2 24863836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACAGAGGCCCTACAAAG -3'
(R):5'- CTTGCGTTCAGTCGAATGG -3'

Sequencing Primer
(F):5'- ACCATGGATTCTGCTGCAG -3'
(R):5'- AATGGATTCGTTGACAGGACCTCC -3'
Posted On2019-10-24