Mutagenetix > Incidental Mutations

Incidental Mutation 'R7633:Olfr1287'

589741

Institutional Source

Beutler Lab

Gene Symbol

Olfr1287

Ensembl Gene

ENSMUSG00000095586

Gene Name

olfactory receptor 1287

Synonyms

MOR248-15, GA_x6K02T2Q125-72500603-72501520

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R7633 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111449142-111450059 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111449622 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 161 (I161V)

Ref Sequence

ENSEMBL: ENSMUSP00000074850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075390]

Predicted Effect

probably benign
Transcript: ENSMUST00000075390
AA Change: I161V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000074850
Gene: ENSMUSG00000095586
AA Change: I161V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	304	6.7e-48	PFAM
Pfam:7tm_1	41	287	9.5e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	C	A	11: 58,447,478	M29I	probably benign	Het
A530084C06Rik	G	T	13: 31,558,995	R92S	unknown	Het
Acaca	A	G	11: 84,372,639	I2029V	probably benign	Het
Anks1b	A	C	10: 90,948,584	D1138A	probably damaging	Het
Atr	T	A	9: 95,947,118	V2508E	probably damaging	Het
C4b	C	T	17: 34,729,399		probably null	Het
C530008M17Rik	A	G	5: 76,857,520	E576G	unknown	Het
Cd46	A	T	1: 195,083,619	M146K	probably null	Het
Chp1	A	G	2: 119,560,745	I28V	probably benign	Het
Chrnb1	T	A	11: 69,792,873	R216W	probably damaging	Het
Clmn	G	A	12: 104,782,112	T392M	probably benign	Het
Dcxr	A	C	11: 120,726,453	L88R	probably benign	Het
Dedd	C	T	1: 171,338,910	P138L	probably benign	Het
Degs1	A	G	1: 182,279,698	S35P	probably damaging	Het
Ehmt1	T	C	2: 24,815,780	D851G	possibly damaging	Het
Fam117b	A	G	1: 59,981,534	D521G	probably damaging	Het
Fam26d	G	A	10: 34,043,908	T121M	possibly damaging	Het
Gm14085	A	T	2: 122,486,680	R7S	probably null	Het
Gm21731	G	A	13: 120,240,840	W57*	probably null	Het
Gm6882	A	G	7: 21,427,652	V97A	probably damaging	Het
Hgs	A	T	11: 120,474,302	Q172L	probably damaging	Het
Hormad2	T	C	11: 4,346,662	Q274R	probably benign	Het
Igkv8-19	C	T	6: 70,341,399		probably benign	Het
Ikbkb	T	C	8: 22,671,741	N377S	probably benign	Het
Intu	G	A	3: 40,654,253	G232S	probably damaging	Het
Mov10	A	G	3: 104,797,065	S806P	possibly damaging	Het
Mrgprb1	A	G	7: 48,447,583	F194L	probably benign	Het
Notch3	A	T	17: 32,158,622	I160K	probably benign	Het
Nup155	C	G	15: 8,109,453	S3W	probably damaging	Het
Olfr284	A	G	15: 98,340,086	I301T	probably damaging	Het
Plxdc1	A	T	11: 97,956,151	F147L	possibly damaging	Het
Ppfia1	T	C	7: 144,552,436	D33G	possibly damaging	Het
Prdm11	G	A	2: 92,980,654	A200V	probably damaging	Het
Qrich2	A	T	11: 116,456,629	I1123K	unknown	Het
Rgs1	A	G	1: 144,248,477		probably null	Het
Skint7	T	A	4: 111,984,140	V259E	probably benign	Het
Slc25a3	A	T	10: 91,118,042		probably null	Het
Slco1a6	A	T	6: 142,145,755	I73N	probably damaging	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Smc4	CTA	CTATA	3: 69,018,067		probably benign	Het
Spock2	G	A	10: 60,126,180	D206N	probably damaging	Het
Stard3nl	T	G	13: 19,367,838	R185S	probably damaging	Het
Supt16	A	G	14: 52,197,099	Y18H	probably benign	Het
Synpo	G	A	18: 60,603,428	T482I	probably damaging	Het
Tmc6	G	T	11: 117,769,220	T694K	probably benign	Het
Trim59	T	A	3: 69,037,926	H27L	probably damaging	Het
Trpv2	G	A	11: 62,591,006		probably null	Het
Tyw5	A	T	1: 57,393,485	D117E	probably benign	Het
Usp17la	T	C	7: 104,861,147	Y320H	probably damaging	Het
Usp31	T	C	7: 121,658,962	D694G	probably damaging	Het
Vmn1r159	T	A	7: 22,843,023	T195S	probably damaging	Het
Vmn2r57	C	T	7: 41,425,089	V517M	possibly damaging	Het
Yipf1	A	G	4: 107,318,996	N29S	probably benign	Het
Zfp954	A	T	7: 7,115,824	F240L	possibly damaging	Het

Other mutations in Olfr1287

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01655:Olfr1287	APN	2	111449889	missense	probably benign	0.13
IGL01748:Olfr1287	APN	2	111449530	missense	probably damaging	1.00
IGL02264:Olfr1287	APN	2	111449862	missense	probably benign	0.05
IGL02371:Olfr1287	APN	2	111450009	missense	probably damaging	1.00
IGL02385:Olfr1287	APN	2	111449350	missense	probably damaging	1.00
IGL02704:Olfr1287	APN	2	111449147	missense	probably benign	0.00
R0368:Olfr1287	UTSW	2	111449788	missense	probably benign	0.07
R1520:Olfr1287	UTSW	2	111449274	missense	probably benign	0.00
R2036:Olfr1287	UTSW	2	111449626	missense	possibly damaging	0.80
R2890:Olfr1287	UTSW	2	111449289	missense	probably benign	0.12
R3757:Olfr1287	UTSW	2	111449257	missense	possibly damaging	0.95
R3801:Olfr1287	UTSW	2	111449565	missense	probably benign	0.07
R3958:Olfr1287	UTSW	2	111449885	missense	possibly damaging	0.50
R4077:Olfr1287	UTSW	2	111449503	missense	probably damaging	0.99
R4763:Olfr1287	UTSW	2	111449678	nonsense	probably null
R4955:Olfr1287	UTSW	2	111449605	missense	probably damaging	1.00
R4975:Olfr1287	UTSW	2	111449683	missense	probably benign	0.16
R5046:Olfr1287	UTSW	2	111449589	missense	probably benign	0.01
R5512:Olfr1287	UTSW	2	111449754	missense	probably benign	0.00
R5708:Olfr1287	UTSW	2	111450009	missense	probably damaging	1.00
R5771:Olfr1287	UTSW	2	111450061	splice site	probably null
R5780:Olfr1287	UTSW	2	111449833	missense	probably benign	0.03
R6981:Olfr1287	UTSW	2	111449352	missense	probably benign	0.00
R7073:Olfr1287	UTSW	2	111449286	missense	probably benign	0.22
R7963:Olfr1287	UTSW	2	111449626	missense	possibly damaging	0.80
R8121:Olfr1287	UTSW	2	111449160	missense	probably benign	0.20
RF037:Olfr1287	UTSW	2	111449551	missense	not run
RF039:Olfr1287	UTSW	2	111449551	missense	not run
Z1088:Olfr1287	UTSW	2	111449457	missense	probably benign	0.02
Z1176:Olfr1287	UTSW	2	111449784	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CATGAGCCAGATCCTCTGTG -3'
(R):5'- TGCCTTTGATGAACCATCTTTAGAG -3'

Sequencing Primer
(F):5'- ATGAGCCAGATCCTCTGTGTGTAC -3'
(R):5'- CCATCTTTAGAGTGAAGTTGAACAG -3'

Posted On

2019-10-24