Incidental Mutation 'R7633:Olfr1287'
ID589741
Institutional Source Beutler Lab
Gene Symbol Olfr1287
Ensembl Gene ENSMUSG00000095586
Gene Nameolfactory receptor 1287
SynonymsMOR248-15, GA_x6K02T2Q125-72500603-72501520
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111449142-111450059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111449622 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 161 (I161V)
Ref Sequence ENSEMBL: ENSMUSP00000074850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075390]
Predicted Effect probably benign
Transcript: ENSMUST00000075390
AA Change: I161V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074850
Gene: ENSMUSG00000095586
AA Change: I161V

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.7e-48 PFAM
Pfam:7tm_1 41 287 9.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Olfr1287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr1287 APN 2 111449889 missense probably benign 0.13
IGL01748:Olfr1287 APN 2 111449530 missense probably damaging 1.00
IGL02264:Olfr1287 APN 2 111449862 missense probably benign 0.05
IGL02371:Olfr1287 APN 2 111450009 missense probably damaging 1.00
IGL02385:Olfr1287 APN 2 111449350 missense probably damaging 1.00
IGL02704:Olfr1287 APN 2 111449147 missense probably benign 0.00
R0368:Olfr1287 UTSW 2 111449788 missense probably benign 0.07
R1520:Olfr1287 UTSW 2 111449274 missense probably benign 0.00
R2036:Olfr1287 UTSW 2 111449626 missense possibly damaging 0.80
R2890:Olfr1287 UTSW 2 111449289 missense probably benign 0.12
R3757:Olfr1287 UTSW 2 111449257 missense possibly damaging 0.95
R3801:Olfr1287 UTSW 2 111449565 missense probably benign 0.07
R3958:Olfr1287 UTSW 2 111449885 missense possibly damaging 0.50
R4077:Olfr1287 UTSW 2 111449503 missense probably damaging 0.99
R4763:Olfr1287 UTSW 2 111449678 nonsense probably null
R4955:Olfr1287 UTSW 2 111449605 missense probably damaging 1.00
R4975:Olfr1287 UTSW 2 111449683 missense probably benign 0.16
R5046:Olfr1287 UTSW 2 111449589 missense probably benign 0.01
R5512:Olfr1287 UTSW 2 111449754 missense probably benign 0.00
R5708:Olfr1287 UTSW 2 111450009 missense probably damaging 1.00
R5771:Olfr1287 UTSW 2 111450061 unclassified probably null
R5780:Olfr1287 UTSW 2 111449833 missense probably benign 0.03
R6981:Olfr1287 UTSW 2 111449352 missense probably benign 0.00
R7073:Olfr1287 UTSW 2 111449286 missense probably benign 0.22
RF037:Olfr1287 UTSW 2 111449551 missense not run
RF039:Olfr1287 UTSW 2 111449551 missense not run
Z1088:Olfr1287 UTSW 2 111449457 missense probably benign 0.02
Z1176:Olfr1287 UTSW 2 111449784 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATGAGCCAGATCCTCTGTG -3'
(R):5'- TGCCTTTGATGAACCATCTTTAGAG -3'

Sequencing Primer
(F):5'- ATGAGCCAGATCCTCTGTGTGTAC -3'
(R):5'- CCATCTTTAGAGTGAAGTTGAACAG -3'
Posted On2019-10-24