Incidental Mutation 'R7633:Intu'
ID589744
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40654253 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 232 (G232S)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
Predicted Effect probably damaging
Transcript: ENSMUST00000061590
AA Change: G214S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: G214S

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000091186
AA Change: G232S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: G232S

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Meta Mutation Damage Score 0.6134 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
R8860:Intu UTSW 3 40672732 missense probably benign 0.07
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTACAAGGATGTGACCGTCTAC -3'
(R):5'- CAGTCTGAACTAGCGGCATG -3'

Sequencing Primer
(F):5'- GGATGTGACCGTCTACATCAAC -3'
(R):5'- TCTGAACTAGCGGCATGTGTCC -3'
Posted On2019-10-24