Incidental Mutation 'R7633:Slco1a6'
ID589752
Institutional Source Beutler Lab
Gene Symbol Slco1a6
Ensembl Gene ENSMUSG00000079262
Gene Namesolute carrier organic anion transporter family, member 1a6
SynonymsSlc21a13, organic anion-transporting polypeptide, 4930422F19Rik, Oatp-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142085761-142208521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142145755 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 73 (I73N)
Ref Sequence ENSEMBL: ENSMUSP00000107458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111827]
Predicted Effect probably damaging
Transcript: ENSMUST00000111827
AA Change: I73N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107458
Gene: ENSMUSG00000079262
AA Change: I73N

DomainStartEndE-ValueType
Pfam:MFS_1 21 421 7.8e-26 PFAM
Pfam:OATP 21 597 1.3e-163 PFAM
Pfam:Kazal_2 445 486 2.7e-11 PFAM
transmembrane domain 600 619 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Slco1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Slco1a6 APN 6 142161017 missense probably benign 0.00
IGL00430:Slco1a6 APN 6 142101651 nonsense probably null
IGL00541:Slco1a6 APN 6 142096299 missense possibly damaging 0.67
IGL01340:Slco1a6 APN 6 142109383 missense possibly damaging 0.71
IGL01693:Slco1a6 APN 6 142133209 nonsense probably null
IGL01713:Slco1a6 APN 6 142086567 missense possibly damaging 0.87
IGL01828:Slco1a6 APN 6 142096411 missense probably damaging 1.00
IGL02049:Slco1a6 APN 6 142101583 splice site probably benign
IGL02085:Slco1a6 APN 6 142086474 missense probably benign 0.00
IGL02245:Slco1a6 APN 6 142109424 missense probably damaging 1.00
IGL02549:Slco1a6 APN 6 142096415 splice site probably benign
IGL02698:Slco1a6 APN 6 142103011 nonsense probably null
IGL02948:Slco1a6 APN 6 142133235 splice site probably null
IGL03075:Slco1a6 APN 6 142103149 splice site probably benign
PIT4585001:Slco1a6 UTSW 6 142109520 missense probably damaging 0.99
R0008:Slco1a6 UTSW 6 142157222 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0173:Slco1a6 UTSW 6 142103122 missense probably benign 0.10
R1642:Slco1a6 UTSW 6 142086434 missense probably benign 0.00
R1939:Slco1a6 UTSW 6 142133230 missense probably damaging 1.00
R2256:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2257:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2696:Slco1a6 UTSW 6 142112936 missense probably damaging 1.00
R2902:Slco1a6 UTSW 6 142096320 missense probably damaging 1.00
R4602:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4611:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4958:Slco1a6 UTSW 6 142145705 missense probably damaging 1.00
R5256:Slco1a6 UTSW 6 142132701 missense probably benign 0.39
R5347:Slco1a6 UTSW 6 142086599 missense probably damaging 0.98
R6130:Slco1a6 UTSW 6 142086429 missense probably benign 0.26
R6384:Slco1a6 UTSW 6 142109379 missense probably benign 0.01
R6543:Slco1a6 UTSW 6 142133146 missense probably benign 0.00
R6662:Slco1a6 UTSW 6 142133215 missense probably damaging 0.97
R6687:Slco1a6 UTSW 6 142099350 missense possibly damaging 0.91
R6702:Slco1a6 UTSW 6 142103100 missense probably damaging 0.99
R7012:Slco1a6 UTSW 6 142086561 missense probably benign 0.02
R7140:Slco1a6 UTSW 6 142103019 missense probably benign 0.00
R7392:Slco1a6 UTSW 6 142157277 missense probably benign 0.00
R7399:Slco1a6 UTSW 6 142091068 missense probably benign 0.01
R7476:Slco1a6 UTSW 6 142103001 missense possibly damaging 0.71
R7621:Slco1a6 UTSW 6 142161017 missense probably damaging 0.96
R8139:Slco1a6 UTSW 6 142089900 missense probably damaging 1.00
R8177:Slco1a6 UTSW 6 142101734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGAGAGGAAATTCAGAGCTTC -3'
(R):5'- AGCAGTCCAGGAGGGTTATAATGTC -3'

Sequencing Primer
(F):5'- GAGAGGAAATTCAGAGCTTCATTTCC -3'
(R):5'- CCAGGAGGGTTATAATGTCTGGAC -3'
Posted On2019-10-24