Incidental Mutation 'R7633:Zfp954'
ID 589753
Institutional Source Beutler Lab
Gene Symbol Zfp954
Ensembl Gene ENSMUSG00000062116
Gene Name zinc finger protein 954
Synonyms 5730403M16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 7114690-7121488 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7115824 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 240 (F240L)
Ref Sequence ENSEMBL: ENSMUSP00000072585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056246]
AlphaFold Q7TNU5
Predicted Effect possibly damaging
Transcript: ENSMUST00000056246
AA Change: F240L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072585
Gene: ENSMUSG00000062116
AA Change: F240L

DomainStartEndE-ValueType
KRAB 42 102 4.6e-14 SMART
ZnF_C2H2 198 220 5.14e-3 SMART
ZnF_C2H2 226 248 3.21e-4 SMART
ZnF_C2H2 254 276 3.63e-3 SMART
ZnF_C2H2 282 304 7.9e-4 SMART
ZnF_C2H2 310 332 1.69e-3 SMART
ZnF_C2H2 338 360 1.26e-2 SMART
ZnF_C2H2 364 386 2.01e-5 SMART
ZnF_C2H2 392 414 1.26e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Other mutations in Zfp954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Zfp954 APN 7 7115367 missense probably benign 0.01
IGL01696:Zfp954 APN 7 7115398 missense probably damaging 1.00
R0196:Zfp954 UTSW 7 7115391 missense probably damaging 1.00
R1723:Zfp954 UTSW 7 7115838 missense probably benign 0.04
R2112:Zfp954 UTSW 7 7115610 missense probably damaging 1.00
R2255:Zfp954 UTSW 7 7115322 missense possibly damaging 0.84
R2410:Zfp954 UTSW 7 7117809 missense probably benign 0.03
R5118:Zfp954 UTSW 7 7115715 missense probably benign 0.05
R5191:Zfp954 UTSW 7 7116023 missense probably damaging 0.96
R5832:Zfp954 UTSW 7 7115390 missense probably damaging 0.97
R5851:Zfp954 UTSW 7 7115625 nonsense probably null
R7646:Zfp954 UTSW 7 7115721 missense possibly damaging 0.65
R7710:Zfp954 UTSW 7 7117890 missense probably damaging 1.00
R8079:Zfp954 UTSW 7 7115471 missense probably benign 0.02
R9054:Zfp954 UTSW 7 7116098 missense probably benign 0.15
R9192:Zfp954 UTSW 7 7115934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCGGAGTTCTGGGTGAAATAC -3'
(R):5'- TCAGGCATCAGGTGACTTCC -3'

Sequencing Primer
(F):5'- GAAATGATTCAGAAGGCCCTCTCTG -3'
(R):5'- CATCAGGTGACTTCCAGTGG -3'
Posted On 2019-10-24