Incidental Mutation 'R7633:Vmn2r57'
ID589756
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Namevomeronasal 2, receptor 57
SynonymsEG269902
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location41399732-41448641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41425089 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 517 (V517M)
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect possibly damaging
Transcript: ENSMUST00000165029
AA Change: V517M

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: V517M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41428785 missense probably benign
IGL01108:Vmn2r57 APN 7 41427584 missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41425043 missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41399946 missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41400195 missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41400450 missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41428226 missense probably benign
IGL02801:Vmn2r57 APN 7 41448632 missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41428074 missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41399741 missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41400652 missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41399733 splice site probably null
R0305:Vmn2r57 UTSW 7 41427543 missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41428801 missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41427804 missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41428211 missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41427830 missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41400124 missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41400643 missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41428107 missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41448577 missense probably benign 0.00
R2197:Vmn2r57 UTSW 7 41428825 critical splice acceptor site probably null
R2242:Vmn2r57 UTSW 7 41428074 missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41400195 missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41428130 missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41428239 missense probably benign
R4423:Vmn2r57 UTSW 7 41426640 missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41400468 missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41400495 missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41428662 missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41426550 critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41400240 missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41427939 missense probably damaging 0.96
R5289:Vmn2r57 UTSW 7 41399974 missense probably damaging 0.99
R5745:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41448472 missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41428690 missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41399860 missense probably benign
R6381:Vmn2r57 UTSW 7 41428818 missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41428665 missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41399794 missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41400286 missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41426724 missense probably benign 0.01
R7811:Vmn2r57 UTSW 7 41425015 nonsense probably null
R8025:Vmn2r57 UTSW 7 41426759 missense probably benign 0.00
X0026:Vmn2r57 UTSW 7 41428125 missense probably benign 0.03
X0026:Vmn2r57 UTSW 7 41428561 missense possibly damaging 0.91
X0065:Vmn2r57 UTSW 7 41427971 missense probably benign 0.09
Z1176:Vmn2r57 UTSW 7 41400498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAACTACTGGGCAAGAGCTTATCTC -3'
(R):5'- GCATGGTATTGGGCCAAAATG -3'

Sequencing Primer
(F):5'- GAGCTTATCTCTTACTTATCTCCAGG -3'
(R):5'- CATGGTATTGGGCCAAAATGTAAAC -3'
Posted On2019-10-24