Incidental Mutation 'R7633:Mrgprb1'
ID 589757
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene Name MAS-related GPR, member B1
Synonyms MrgB1
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 48093861-48106090 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48097331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 194 (F194L)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
AlphaFold Q3UG61
Predicted Effect probably benign
Transcript: ENSMUST00000094384
AA Change: F194L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: F194L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably benign
Transcript: ENSMUST00000188918
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547

DomainStartEndE-ValueType
SCOP:d1l9ha_ 23 84 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Fam117b A G 1: 60,020,693 (GRCm39) D521G probably damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hgs A T 11: 120,365,128 (GRCm39) Q172L probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Or8s5 A G 15: 98,237,967 (GRCm39) I301T probably damaging Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Ppfia1 T C 7: 144,106,173 (GRCm39) D33G possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Qrich2 A T 11: 116,347,455 (GRCm39) I1123K unknown Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Synpo G A 18: 60,736,500 (GRCm39) T482I probably damaging Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Tyw5 A T 1: 57,432,644 (GRCm39) D117E probably benign Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48,097,291 (GRCm39) missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48,097,775 (GRCm39) missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48,097,754 (GRCm39) missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48,097,409 (GRCm39) missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48,097,465 (GRCm39) missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48,096,952 (GRCm39) missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48,096,962 (GRCm39) missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48,105,932 (GRCm39) splice site probably benign
R1223:Mrgprb1 UTSW 7 48,097,435 (GRCm39) missense possibly damaging 0.61
R1327:Mrgprb1 UTSW 7 48,097,177 (GRCm39) missense possibly damaging 0.87
R1456:Mrgprb1 UTSW 7 48,097,777 (GRCm39) missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48,096,873 (GRCm39) splice site probably null
R1567:Mrgprb1 UTSW 7 48,097,201 (GRCm39) missense probably damaging 0.97
R2030:Mrgprb1 UTSW 7 48,097,076 (GRCm39) missense possibly damaging 0.83
R2165:Mrgprb1 UTSW 7 48,097,070 (GRCm39) missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48,097,469 (GRCm39) missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48,097,076 (GRCm39) missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48,097,829 (GRCm39) missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48,096,871 (GRCm39) missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48,097,456 (GRCm39) missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48,097,739 (GRCm39) missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48,097,225 (GRCm39) missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48,097,719 (GRCm39) missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48,097,523 (GRCm39) missense probably benign 0.06
R5595:Mrgprb1 UTSW 7 48,097,432 (GRCm39) missense probably damaging 0.99
R5982:Mrgprb1 UTSW 7 48,097,568 (GRCm39) missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48,097,645 (GRCm39) missense possibly damaging 0.82
R7066:Mrgprb1 UTSW 7 48,097,424 (GRCm39) missense probably benign 0.27
R7141:Mrgprb1 UTSW 7 48,097,435 (GRCm39) missense possibly damaging 0.61
R8072:Mrgprb1 UTSW 7 48,097,895 (GRCm39) nonsense probably null
R8080:Mrgprb1 UTSW 7 48,096,658 (GRCm39) splice site probably null
R8112:Mrgprb1 UTSW 7 48,097,682 (GRCm39) missense probably damaging 0.97
R8493:Mrgprb1 UTSW 7 48,097,321 (GRCm39) missense probably damaging 0.99
R8817:Mrgprb1 UTSW 7 48,097,070 (GRCm39) missense probably benign 0.01
R9135:Mrgprb1 UTSW 7 48,097,046 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACTCTAAGAGGAACCAGTAGATCC -3'
(R):5'- AGTGGTCTGAGCATCCTCAC -3'

Sequencing Primer
(F):5'- GTAGATCCCATAGGGCAGACC -3'
(R):5'- TCACTGTCATTAGCACTGAACG -3'
Posted On 2019-10-24