Incidental Mutation 'R7633:Usp31'
ID589759
Institutional Source Beutler Lab
Gene Symbol Usp31
Ensembl Gene ENSMUSG00000063317
Gene Nameubiquitin specific peptidase 31
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121642021-121707253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121658962 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 694 (D694G)
Ref Sequence ENSEMBL: ENSMUSP00000040037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046929]
Predicted Effect probably damaging
Transcript: ENSMUST00000046929
AA Change: D694G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040037
Gene: ENSMUSG00000063317
AA Change: D694G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 90 120 N/A INTRINSIC
Pfam:UCH 122 755 2.5e-64 PFAM
Pfam:UCH_1 562 737 1.3e-12 PFAM
low complexity region 763 777 N/A INTRINSIC
low complexity region 792 811 N/A INTRINSIC
low complexity region 831 847 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
low complexity region 1009 1030 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1072 1127 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1192 1204 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205473
Meta Mutation Damage Score 0.3681 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Usp31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Usp31 APN 7 121706670 missense probably damaging 1.00
IGL00421:Usp31 APN 7 121648650 missense probably damaging 0.96
IGL00657:Usp31 APN 7 121648231 missense probably benign 0.00
IGL01917:Usp31 APN 7 121679485 missense probably benign 0.26
IGL02444:Usp31 APN 7 121679495 missense probably damaging 1.00
IGL03090:Usp31 APN 7 121679530 splice site probably benign
R0334:Usp31 UTSW 7 121658962 missense probably damaging 0.99
R0945:Usp31 UTSW 7 121670253 missense probably damaging 1.00
R1326:Usp31 UTSW 7 121648302 missense probably damaging 1.00
R2116:Usp31 UTSW 7 121648696 missense probably benign 0.39
R3113:Usp31 UTSW 7 121679513 missense probably damaging 1.00
R4072:Usp31 UTSW 7 121667782 splice site probably null
R4075:Usp31 UTSW 7 121667782 splice site probably null
R4076:Usp31 UTSW 7 121667782 splice site probably null
R4306:Usp31 UTSW 7 121706929 missense possibly damaging 0.93
R4675:Usp31 UTSW 7 121707325 unclassified probably benign
R4960:Usp31 UTSW 7 121648645 missense probably damaging 0.99
R5368:Usp31 UTSW 7 121661365 missense probably damaging 1.00
R5396:Usp31 UTSW 7 121667782 splice site probably null
R5456:Usp31 UTSW 7 121670277 missense probably damaging 1.00
R5475:Usp31 UTSW 7 121651526 missense probably damaging 1.00
R5497:Usp31 UTSW 7 121651601 missense probably damaging 1.00
R5872:Usp31 UTSW 7 121649475 missense probably benign 0.05
R6301:Usp31 UTSW 7 121648276 missense possibly damaging 0.76
R6688:Usp31 UTSW 7 121678330 missense probably benign 0.01
R6875:Usp31 UTSW 7 121649640 nonsense probably null
R6895:Usp31 UTSW 7 121653176 missense probably benign 0.00
R7570:Usp31 UTSW 7 121674963 missense probably damaging 1.00
R7666:Usp31 UTSW 7 121649181 missense possibly damaging 0.68
R7841:Usp31 UTSW 7 121648456 missense probably benign 0.00
R7841:Usp31 UTSW 7 121677312 missense probably damaging 0.96
R7924:Usp31 UTSW 7 121648456 missense probably benign 0.00
R7924:Usp31 UTSW 7 121677312 missense probably damaging 0.96
R8013:Usp31 UTSW 7 121649257 missense probably damaging 0.99
R8014:Usp31 UTSW 7 121649257 missense probably damaging 0.99
X0062:Usp31 UTSW 7 121651514 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCTCAGAGCTGGCAAAAGGC -3'
(R):5'- TAAACTGATCTGCCATCTGCTTG -3'

Sequencing Primer
(F):5'- CAAAAGGCACACTGGAAGAC -3'
(R):5'- GCCATCTGCTTGCATTAAAATGTC -3'
Posted On2019-10-24