Incidental Mutation 'R7633:Usp31'
ID 589759
Institutional Source Beutler Lab
Gene Symbol Usp31
Ensembl Gene ENSMUSG00000063317
Gene Name ubiquitin specific peptidase 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 121642021-121707253 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121658962 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 694 (D694G)
Ref Sequence ENSEMBL: ENSMUSP00000040037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046929]
AlphaFold E9Q6Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000046929
AA Change: D694G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040037
Gene: ENSMUSG00000063317
AA Change: D694G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 90 120 N/A INTRINSIC
Pfam:UCH 122 755 2.5e-64 PFAM
Pfam:UCH_1 562 737 1.3e-12 PFAM
low complexity region 763 777 N/A INTRINSIC
low complexity region 792 811 N/A INTRINSIC
low complexity region 831 847 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
low complexity region 1009 1030 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1072 1127 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1192 1204 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205473
Meta Mutation Damage Score 0.3681 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Usp31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Usp31 APN 7 121706670 missense probably damaging 1.00
IGL00421:Usp31 APN 7 121648650 missense probably damaging 0.96
IGL00657:Usp31 APN 7 121648231 missense probably benign 0.00
IGL01917:Usp31 APN 7 121679485 missense probably benign 0.26
IGL02444:Usp31 APN 7 121679495 missense probably damaging 1.00
IGL03090:Usp31 APN 7 121679530 splice site probably benign
R0334:Usp31 UTSW 7 121658962 missense probably damaging 0.99
R0945:Usp31 UTSW 7 121670253 missense probably damaging 1.00
R1326:Usp31 UTSW 7 121648302 missense probably damaging 1.00
R2116:Usp31 UTSW 7 121648696 missense probably benign 0.39
R3113:Usp31 UTSW 7 121679513 missense probably damaging 1.00
R4072:Usp31 UTSW 7 121667782 splice site probably null
R4075:Usp31 UTSW 7 121667782 splice site probably null
R4076:Usp31 UTSW 7 121667782 splice site probably null
R4306:Usp31 UTSW 7 121706929 missense possibly damaging 0.93
R4675:Usp31 UTSW 7 121707325 unclassified probably benign
R4960:Usp31 UTSW 7 121648645 missense probably damaging 0.99
R5368:Usp31 UTSW 7 121661365 missense probably damaging 1.00
R5396:Usp31 UTSW 7 121667782 splice site probably null
R5456:Usp31 UTSW 7 121670277 missense probably damaging 1.00
R5475:Usp31 UTSW 7 121651526 missense probably damaging 1.00
R5497:Usp31 UTSW 7 121651601 missense probably damaging 1.00
R5872:Usp31 UTSW 7 121649475 missense probably benign 0.05
R6301:Usp31 UTSW 7 121648276 missense possibly damaging 0.76
R6688:Usp31 UTSW 7 121678330 missense probably benign 0.01
R6875:Usp31 UTSW 7 121649640 nonsense probably null
R6895:Usp31 UTSW 7 121653176 missense probably benign 0.00
R7570:Usp31 UTSW 7 121674963 missense probably damaging 1.00
R7666:Usp31 UTSW 7 121649181 missense possibly damaging 0.68
R7841:Usp31 UTSW 7 121648456 missense probably benign 0.00
R7841:Usp31 UTSW 7 121677312 missense probably damaging 0.96
R8013:Usp31 UTSW 7 121649257 missense probably damaging 0.99
R8014:Usp31 UTSW 7 121649257 missense probably damaging 0.99
R8118:Usp31 UTSW 7 121677262 missense probably damaging 1.00
R8140:Usp31 UTSW 7 121649026 missense possibly damaging 0.79
R9063:Usp31 UTSW 7 121707243 missense probably benign
X0062:Usp31 UTSW 7 121651514 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCTCAGAGCTGGCAAAAGGC -3'
(R):5'- TAAACTGATCTGCCATCTGCTTG -3'

Sequencing Primer
(F):5'- CAAAAGGCACACTGGAAGAC -3'
(R):5'- GCCATCTGCTTGCATTAAAATGTC -3'
Posted On 2019-10-24