Incidental Mutation 'R7633:Ppfia1'
ID589760
Institutional Source Beutler Lab
Gene Symbol Ppfia1
Ensembl Gene ENSMUSG00000037519
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
SynonymsLiprin-alpha1, liprin, C030014K08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location144476758-144553729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144552436 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 33 (D33G)
Ref Sequence ENSEMBL: ENSMUSP00000138312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168134] [ENSMUST00000182226] [ENSMUST00000182731]
Predicted Effect probably damaging
Transcript: ENSMUST00000168134
AA Change: D33G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126233
Gene: ENSMUSG00000037519
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 517 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
coiled coil region 621 667 N/A INTRINSIC
low complexity region 681 703 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 791 799 N/A INTRINSIC
SAM 884 953 5.22e-7 SMART
low complexity region 954 966 N/A INTRINSIC
SAM 999 1066 3.89e-6 SMART
SAM 1087 1159 1.14e-7 SMART
low complexity region 1207 1218 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182226
AA Change: D33G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138312
Gene: ENSMUSG00000037519
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 389 N/A INTRINSIC
coiled coil region 411 542 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
coiled coil region 646 692 N/A INTRINSIC
low complexity region 706 728 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
SAM 909 978 5.22e-7 SMART
low complexity region 979 991 N/A INTRINSIC
SAM 1024 1091 3.89e-6 SMART
SAM 1112 1184 1.14e-7 SMART
low complexity region 1232 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182731
SMART Domains Protein: ENSMUSP00000138238
Gene: ENSMUSG00000037519

DomainStartEndE-ValueType
coiled coil region 32 67 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Ppfia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Ppfia1 APN 7 144481719 missense probably benign 0.00
IGL01771:Ppfia1 APN 7 144482357 missense probably benign 0.36
IGL02220:Ppfia1 APN 7 144481775 missense probably damaging 1.00
IGL02683:Ppfia1 APN 7 144513358 missense probably damaging 0.99
IGL02752:Ppfia1 APN 7 144519604 missense probably benign
PIT1430001:Ppfia1 UTSW 7 144498336 missense probably damaging 1.00
R0081:Ppfia1 UTSW 7 144504974 missense probably damaging 1.00
R0304:Ppfia1 UTSW 7 144482345 missense probably damaging 1.00
R0359:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R1836:Ppfia1 UTSW 7 144519631 missense probably benign 0.19
R1934:Ppfia1 UTSW 7 144505110 missense probably benign 0.12
R2195:Ppfia1 UTSW 7 144516107 missense probably damaging 1.00
R3759:Ppfia1 UTSW 7 144516002 missense probably benign 0.34
R3843:Ppfia1 UTSW 7 144504970 missense probably benign 0.31
R4606:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R4820:Ppfia1 UTSW 7 144498369 missense probably benign 0.33
R4898:Ppfia1 UTSW 7 144491576 missense probably damaging 1.00
R5069:Ppfia1 UTSW 7 144514473 nonsense probably null
R5070:Ppfia1 UTSW 7 144514473 nonsense probably null
R5076:Ppfia1 UTSW 7 144506264 missense probably damaging 1.00
R5280:Ppfia1 UTSW 7 144485095 missense possibly damaging 0.84
R5473:Ppfia1 UTSW 7 144491492 missense probably benign 0.17
R5656:Ppfia1 UTSW 7 144519974 critical splice donor site probably null
R5818:Ppfia1 UTSW 7 144520568 intron probably benign
R6104:Ppfia1 UTSW 7 144491574 missense possibly damaging 0.95
R6299:Ppfia1 UTSW 7 144510312 missense probably benign 0.11
R6474:Ppfia1 UTSW 7 144506205 missense possibly damaging 0.89
R6705:Ppfia1 UTSW 7 144519174 missense possibly damaging 0.93
R6734:Ppfia1 UTSW 7 144479053 missense probably damaging 1.00
R7062:Ppfia1 UTSW 7 144552473 missense probably benign
R7451:Ppfia1 UTSW 7 144508210 missense probably benign
R7514:Ppfia1 UTSW 7 144517713 missense probably benign 0.01
R7552:Ppfia1 UTSW 7 144506245 missense probably damaging 1.00
R7886:Ppfia1 UTSW 7 144519283 missense probably benign
R7969:Ppfia1 UTSW 7 144519283 missense probably benign
R8038:Ppfia1 UTSW 7 144514916 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCATACCTGTGGAAGTGCAG -3'
(R):5'- TGATCGTCACGGATAGCTCTGG -3'

Sequencing Primer
(F):5'- AAGTGCAGTATTGAGCTGCCTC -3'
(R):5'- ATAGCTCTGGGGCTGTCAGC -3'
Posted On2019-10-24