Mutagenetix > Incidental Mutation

Incidental Mutation 'R7633:Ppfia1'

589760

Institutional Source

Beutler Lab

Gene Symbol

Ppfia1

Ensembl Gene

ENSMUSG00000037519

Gene Name

protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1

Synonyms

Liprin-alpha1, liprin, C030014K08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.861) question?

Stock #

R7633 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144476758-144553729 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144552436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 33 (D33G)

Ref Sequence

ENSEMBL: ENSMUSP00000138312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168134] [ENSMUST00000182226] [ENSMUST00000182731]

AlphaFold

B2RXQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000168134
AA Change: D33G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126233
Gene: ENSMUSG00000037519
AA Change: D33G

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
coiled coil region	36	137	N/A	INTRINSIC
coiled coil region	250	517	N/A	INTRINSIC
low complexity region	594	607	N/A	INTRINSIC
coiled coil region	621	667	N/A	INTRINSIC
low complexity region	681	703	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	791	799	N/A	INTRINSIC
SAM	884	953	5.22e-7	SMART
low complexity region	954	966	N/A	INTRINSIC
SAM	999	1066	3.89e-6	SMART
SAM	1087	1159	1.14e-7	SMART
low complexity region	1207	1218	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182226
AA Change: D33G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138312
Gene: ENSMUSG00000037519
AA Change: D33G

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
coiled coil region	36	137	N/A	INTRINSIC
coiled coil region	250	389	N/A	INTRINSIC
coiled coil region	411	542	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
coiled coil region	646	692	N/A	INTRINSIC
low complexity region	706	728	N/A	INTRINSIC
low complexity region	775	785	N/A	INTRINSIC
low complexity region	816	824	N/A	INTRINSIC
SAM	909	978	5.22e-7	SMART
low complexity region	979	991	N/A	INTRINSIC
SAM	1024	1091	3.89e-6	SMART
SAM	1112	1184	1.14e-7	SMART
low complexity region	1232	1243	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182731

SMART Domains

Protein: ENSMUSP00000138238
Gene: ENSMUSG00000037519

Domain	Start	End	E-Value	Type
coiled coil region	32	67	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	C	A	11: 58,447,478	M29I	probably benign	Het
A530084C06Rik	G	T	13: 31,558,995	R92S	unknown	Het
Acaca	A	G	11: 84,372,639	I2029V	probably benign	Het
Anks1b	A	C	10: 90,948,584	D1138A	probably damaging	Het
Atr	T	A	9: 95,947,118	V2508E	probably damaging	Het
C4b	C	T	17: 34,729,399		probably null	Het
C530008M17Rik	A	G	5: 76,857,520	E576G	unknown	Het
Cd46	A	T	1: 195,083,619	M146K	probably null	Het
Chp1	A	G	2: 119,560,745	I28V	probably benign	Het
Chrnb1	T	A	11: 69,792,873	R216W	probably damaging	Het
Clmn	G	A	12: 104,782,112	T392M	probably benign	Het
Dcxr	A	C	11: 120,726,453	L88R	probably benign	Het
Dedd	C	T	1: 171,338,910	P138L	probably benign	Het
Degs1	A	G	1: 182,279,698	S35P	probably damaging	Het
Ehmt1	T	C	2: 24,815,780	D851G	possibly damaging	Het
Fam117b	A	G	1: 59,981,534	D521G	probably damaging	Het
Fam26d	G	A	10: 34,043,908	T121M	possibly damaging	Het
Gm14085	A	T	2: 122,486,680	R7S	probably null	Het
Gm21731	G	A	13: 120,240,840	W57*	probably null	Het
Gm6882	A	G	7: 21,427,652	V97A	probably damaging	Het
Hgs	A	T	11: 120,474,302	Q172L	probably damaging	Het
Hormad2	T	C	11: 4,346,662	Q274R	probably benign	Het
Igkv8-19	C	T	6: 70,341,399		probably benign	Het
Ikbkb	T	C	8: 22,671,741	N377S	probably benign	Het
Intu	G	A	3: 40,654,253	G232S	probably damaging	Het
Mov10	A	G	3: 104,797,065	S806P	possibly damaging	Het
Mrgprb1	A	G	7: 48,447,583	F194L	probably benign	Het
Notch3	A	T	17: 32,158,622	I160K	probably benign	Het
Nup155	C	G	15: 8,109,453	S3W	probably damaging	Het
Olfr1287	A	G	2: 111,449,622	I161V	probably benign	Het
Olfr284	A	G	15: 98,340,086	I301T	probably damaging	Het
Plxdc1	A	T	11: 97,956,151	F147L	possibly damaging	Het
Prdm11	G	A	2: 92,980,654	A200V	probably damaging	Het
Qrich2	A	T	11: 116,456,629	I1123K	unknown	Het
Rgs1	A	G	1: 144,248,477		probably null	Het
Skint7	T	A	4: 111,984,140	V259E	probably benign	Het
Slc25a3	A	T	10: 91,118,042		probably null	Het
Slco1a6	A	T	6: 142,145,755	I73N	probably damaging	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Smc4	CTA	CTATA	3: 69,018,067		probably benign	Het
Spock2	G	A	10: 60,126,180	D206N	probably damaging	Het
Stard3nl	T	G	13: 19,367,838	R185S	probably damaging	Het
Supt16	A	G	14: 52,197,099	Y18H	probably benign	Het
Synpo	G	A	18: 60,603,428	T482I	probably damaging	Het
Tmc6	G	T	11: 117,769,220	T694K	probably benign	Het
Trim59	T	A	3: 69,037,926	H27L	probably damaging	Het
Trpv2	G	A	11: 62,591,006		probably null	Het
Tyw5	A	T	1: 57,393,485	D117E	probably benign	Het
Usp17la	T	C	7: 104,861,147	Y320H	probably damaging	Het
Usp31	T	C	7: 121,658,962	D694G	probably damaging	Het
Vmn1r159	T	A	7: 22,843,023	T195S	probably damaging	Het
Vmn2r57	C	T	7: 41,425,089	V517M	possibly damaging	Het
Yipf1	A	G	4: 107,318,996	N29S	probably benign	Het
Zfp954	A	T	7: 7,115,824	F240L	possibly damaging	Het

Other mutations in Ppfia1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01626:Ppfia1	APN	7	144481719	missense	probably benign	0.00
IGL01771:Ppfia1	APN	7	144482357	missense	probably benign	0.36
IGL02220:Ppfia1	APN	7	144481775	missense	probably damaging	1.00
IGL02683:Ppfia1	APN	7	144513358	missense	probably damaging	0.99
IGL02752:Ppfia1	APN	7	144519604	missense	probably benign
PIT1430001:Ppfia1	UTSW	7	144498336	missense	probably damaging	1.00
R0081:Ppfia1	UTSW	7	144504974	missense	probably damaging	1.00
R0304:Ppfia1	UTSW	7	144482345	missense	probably damaging	1.00
R0359:Ppfia1	UTSW	7	144485192	missense	probably damaging	0.97
R1836:Ppfia1	UTSW	7	144519631	missense	probably benign	0.19
R1934:Ppfia1	UTSW	7	144505110	missense	probably benign	0.12
R2195:Ppfia1	UTSW	7	144516107	missense	probably damaging	1.00
R3759:Ppfia1	UTSW	7	144516002	missense	probably benign	0.34
R3843:Ppfia1	UTSW	7	144504970	missense	probably benign	0.31
R4606:Ppfia1	UTSW	7	144485192	missense	probably damaging	0.97
R4820:Ppfia1	UTSW	7	144498369	missense	probably benign	0.33
R4898:Ppfia1	UTSW	7	144491576	missense	probably damaging	1.00
R5069:Ppfia1	UTSW	7	144514473	nonsense	probably null
R5070:Ppfia1	UTSW	7	144514473	nonsense	probably null
R5076:Ppfia1	UTSW	7	144506264	missense	probably damaging	1.00
R5280:Ppfia1	UTSW	7	144485095	missense	possibly damaging	0.84
R5473:Ppfia1	UTSW	7	144491492	missense	probably benign	0.17
R5656:Ppfia1	UTSW	7	144519974	critical splice donor site	probably null
R5818:Ppfia1	UTSW	7	144520568	intron	probably benign
R6104:Ppfia1	UTSW	7	144491574	missense	possibly damaging	0.95
R6299:Ppfia1	UTSW	7	144510312	missense	probably benign	0.11
R6474:Ppfia1	UTSW	7	144506205	missense	possibly damaging	0.89
R6705:Ppfia1	UTSW	7	144519174	missense	possibly damaging	0.93
R6734:Ppfia1	UTSW	7	144479053	missense	probably damaging	1.00
R7062:Ppfia1	UTSW	7	144552473	missense	probably benign
R7451:Ppfia1	UTSW	7	144508210	missense	probably benign
R7514:Ppfia1	UTSW	7	144517713	missense	probably benign	0.01
R7552:Ppfia1	UTSW	7	144506245	missense	probably damaging	1.00
R7886:Ppfia1	UTSW	7	144519283	missense	probably benign
R8038:Ppfia1	UTSW	7	144514916	missense	possibly damaging	0.67
R8139:Ppfia1	UTSW	7	144520693	missense	probably damaging	1.00
R8266:Ppfia1	UTSW	7	144514494	missense	possibly damaging	0.72
R8859:Ppfia1	UTSW	7	144479025	critical splice donor site	probably null
R9621:Ppfia1	UTSW	7	144498779	missense	probably damaging	1.00
R9722:Ppfia1	UTSW	7	144517665	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- GCATACCTGTGGAAGTGCAG -3'
(R):5'- TGATCGTCACGGATAGCTCTGG -3'

Sequencing Primer
(F):5'- AAGTGCAGTATTGAGCTGCCTC -3'
(R):5'- ATAGCTCTGGGGCTGTCAGC -3'

Posted On

2019-10-24