Incidental Mutation 'R7633:Ppfia1'
ID 589760
Institutional Source Beutler Lab
Gene Symbol Ppfia1
Ensembl Gene ENSMUSG00000037519
Gene Name protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Synonyms Liprin-alpha1, liprin, C030014K08Rik
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.897) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 144030495-144107466 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144106173 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 33 (D33G)
Ref Sequence ENSEMBL: ENSMUSP00000138312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168134] [ENSMUST00000182226] [ENSMUST00000182731]
AlphaFold B2RXQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000168134
AA Change: D33G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126233
Gene: ENSMUSG00000037519
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 517 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
coiled coil region 621 667 N/A INTRINSIC
low complexity region 681 703 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 791 799 N/A INTRINSIC
SAM 884 953 5.22e-7 SMART
low complexity region 954 966 N/A INTRINSIC
SAM 999 1066 3.89e-6 SMART
SAM 1087 1159 1.14e-7 SMART
low complexity region 1207 1218 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182226
AA Change: D33G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138312
Gene: ENSMUSG00000037519
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 389 N/A INTRINSIC
coiled coil region 411 542 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
coiled coil region 646 692 N/A INTRINSIC
low complexity region 706 728 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
SAM 909 978 5.22e-7 SMART
low complexity region 979 991 N/A INTRINSIC
SAM 1024 1091 3.89e-6 SMART
SAM 1112 1184 1.14e-7 SMART
low complexity region 1232 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182731
SMART Domains Protein: ENSMUSP00000138238
Gene: ENSMUSG00000037519

DomainStartEndE-ValueType
coiled coil region 32 67 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Fam117b A G 1: 60,020,693 (GRCm39) D521G probably damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hgs A T 11: 120,365,128 (GRCm39) Q172L probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Mrgprb1 A G 7: 48,097,331 (GRCm39) F194L probably benign Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Or8s5 A G 15: 98,237,967 (GRCm39) I301T probably damaging Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Qrich2 A T 11: 116,347,455 (GRCm39) I1123K unknown Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Synpo G A 18: 60,736,500 (GRCm39) T482I probably damaging Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Tyw5 A T 1: 57,432,644 (GRCm39) D117E probably benign Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Ppfia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Ppfia1 APN 7 144,035,456 (GRCm39) missense probably benign 0.00
IGL01771:Ppfia1 APN 7 144,036,094 (GRCm39) missense probably benign 0.36
IGL02220:Ppfia1 APN 7 144,035,512 (GRCm39) missense probably damaging 1.00
IGL02683:Ppfia1 APN 7 144,067,095 (GRCm39) missense probably damaging 0.99
IGL02752:Ppfia1 APN 7 144,073,341 (GRCm39) missense probably benign
PIT1430001:Ppfia1 UTSW 7 144,052,073 (GRCm39) missense probably damaging 1.00
R0081:Ppfia1 UTSW 7 144,058,711 (GRCm39) missense probably damaging 1.00
R0304:Ppfia1 UTSW 7 144,036,082 (GRCm39) missense probably damaging 1.00
R0359:Ppfia1 UTSW 7 144,038,929 (GRCm39) missense probably damaging 0.97
R1836:Ppfia1 UTSW 7 144,073,368 (GRCm39) missense probably benign 0.19
R1934:Ppfia1 UTSW 7 144,058,847 (GRCm39) missense probably benign 0.12
R2195:Ppfia1 UTSW 7 144,069,844 (GRCm39) missense probably damaging 1.00
R3759:Ppfia1 UTSW 7 144,069,739 (GRCm39) missense probably benign 0.34
R3843:Ppfia1 UTSW 7 144,058,707 (GRCm39) missense probably benign 0.31
R4606:Ppfia1 UTSW 7 144,038,929 (GRCm39) missense probably damaging 0.97
R4820:Ppfia1 UTSW 7 144,052,106 (GRCm39) missense probably benign 0.33
R4898:Ppfia1 UTSW 7 144,045,313 (GRCm39) missense probably damaging 1.00
R5069:Ppfia1 UTSW 7 144,068,210 (GRCm39) nonsense probably null
R5070:Ppfia1 UTSW 7 144,068,210 (GRCm39) nonsense probably null
R5076:Ppfia1 UTSW 7 144,060,001 (GRCm39) missense probably damaging 1.00
R5280:Ppfia1 UTSW 7 144,038,832 (GRCm39) missense possibly damaging 0.84
R5473:Ppfia1 UTSW 7 144,045,229 (GRCm39) missense probably benign 0.17
R5656:Ppfia1 UTSW 7 144,073,711 (GRCm39) critical splice donor site probably null
R5818:Ppfia1 UTSW 7 144,074,305 (GRCm39) intron probably benign
R6104:Ppfia1 UTSW 7 144,045,311 (GRCm39) missense possibly damaging 0.95
R6299:Ppfia1 UTSW 7 144,064,049 (GRCm39) missense probably benign 0.11
R6474:Ppfia1 UTSW 7 144,059,942 (GRCm39) missense possibly damaging 0.89
R6705:Ppfia1 UTSW 7 144,072,911 (GRCm39) missense possibly damaging 0.93
R6734:Ppfia1 UTSW 7 144,032,790 (GRCm39) missense probably damaging 1.00
R7062:Ppfia1 UTSW 7 144,106,210 (GRCm39) missense probably benign
R7451:Ppfia1 UTSW 7 144,061,947 (GRCm39) missense probably benign
R7514:Ppfia1 UTSW 7 144,071,450 (GRCm39) missense probably benign 0.01
R7552:Ppfia1 UTSW 7 144,059,982 (GRCm39) missense probably damaging 1.00
R7886:Ppfia1 UTSW 7 144,073,020 (GRCm39) missense probably benign
R8038:Ppfia1 UTSW 7 144,068,653 (GRCm39) missense possibly damaging 0.67
R8139:Ppfia1 UTSW 7 144,074,430 (GRCm39) missense probably damaging 1.00
R8266:Ppfia1 UTSW 7 144,068,231 (GRCm39) missense possibly damaging 0.72
R8859:Ppfia1 UTSW 7 144,032,762 (GRCm39) critical splice donor site probably null
R9621:Ppfia1 UTSW 7 144,052,516 (GRCm39) missense probably damaging 1.00
R9722:Ppfia1 UTSW 7 144,071,402 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCATACCTGTGGAAGTGCAG -3'
(R):5'- TGATCGTCACGGATAGCTCTGG -3'

Sequencing Primer
(F):5'- AAGTGCAGTATTGAGCTGCCTC -3'
(R):5'- ATAGCTCTGGGGCTGTCAGC -3'
Posted On 2019-10-24