Incidental Mutation 'R7633:Ikbkb'
ID589761
Institutional Source Beutler Lab
Gene Symbol Ikbkb
Ensembl Gene ENSMUSG00000031537
Gene Nameinhibitor of kappaB kinase beta
SynonymsIKK2, IKK[b], IKKbeta, IKK-beta, IKK-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22659212-22706589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22671741 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 377 (N377S)
Ref Sequence ENSEMBL: ENSMUSP00000033939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033939] [ENSMUST00000063401] [ENSMUST00000125314] [ENSMUST00000135326]
Predicted Effect probably benign
Transcript: ENSMUST00000033939
AA Change: N377S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033939
Gene: ENSMUSG00000031537
AA Change: N377S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 1.2e-38 PFAM
Pfam:Pkinase 15 296 1.2e-54 PFAM
Pfam:Kdo 31 176 1.3e-7 PFAM
IKKbetaNEMObind 705 742 4.71e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063401
AA Change: N377S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064235
Gene: ENSMUSG00000031537
AA Change: N377S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 7.3e-39 PFAM
Pfam:Pkinase 15 296 6.9e-56 PFAM
Pfam:Kdo 44 177 3e-8 PFAM
IKKbetaNEMObind 705 737 1.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125314
AA Change: N377S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138156
Gene: ENSMUSG00000031537
AA Change: N377S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135326
AA Change: N377S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138378
Gene: ENSMUSG00000031537
AA Change: N377S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit liver degeneration and die in midgestation. Conditional mutations that lack gene expression in lymphoid cells or epidermal keratinocytes exhibit B and T cell deficits and skin inflammation, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Ikbkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Ikbkb APN 8 22706111 missense probably damaging 0.99
IGL00899:Ikbkb APN 8 22660447 missense possibly damaging 0.84
IGL02271:Ikbkb APN 8 22665903 missense probably benign 0.00
IGL02569:Ikbkb APN 8 22693883 missense probably damaging 1.00
IGL02610:Ikbkb APN 8 22675072 critical splice acceptor site probably null
IGL03085:Ikbkb APN 8 22682786 missense probably benign 0.03
Baby UTSW 8 22675036 missense probably damaging 1.00
Impaired UTSW 8 22666020 missense probably damaging 1.00
Kiki UTSW 8 22671642 missense possibly damaging 0.95
R0110:Ikbkb UTSW 8 22671635 nonsense probably null
R0366:Ikbkb UTSW 8 22695260 splice site probably benign
R0469:Ikbkb UTSW 8 22671635 nonsense probably null
R0510:Ikbkb UTSW 8 22671635 nonsense probably null
R1386:Ikbkb UTSW 8 22665617 missense possibly damaging 0.69
R1436:Ikbkb UTSW 8 22673403 missense probably benign 0.24
R1645:Ikbkb UTSW 8 22691066 missense probably damaging 0.98
R1695:Ikbkb UTSW 8 22673480 missense probably benign 0.00
R2118:Ikbkb UTSW 8 22667217 splice site probably benign
R2120:Ikbkb UTSW 8 22667217 splice site probably benign
R2121:Ikbkb UTSW 8 22667217 splice site probably benign
R2124:Ikbkb UTSW 8 22666020 missense probably damaging 1.00
R2124:Ikbkb UTSW 8 22667217 splice site probably benign
R2148:Ikbkb UTSW 8 22682745 missense probably damaging 1.00
R2179:Ikbkb UTSW 8 22681753 critical splice acceptor site probably null
R2897:Ikbkb UTSW 8 22669677 missense possibly damaging 0.71
R3861:Ikbkb UTSW 8 22678836 missense possibly damaging 0.94
R4019:Ikbkb UTSW 8 22671712 missense probably benign 0.03
R4723:Ikbkb UTSW 8 22669607 missense probably benign 0.24
R4962:Ikbkb UTSW 8 22681677 missense probably damaging 1.00
R5715:Ikbkb UTSW 8 22678850 missense probably damaging 1.00
R6738:Ikbkb UTSW 8 22675036 missense probably damaging 1.00
R6875:Ikbkb UTSW 8 22665893 missense probably damaging 0.99
R7054:Ikbkb UTSW 8 22671642 missense possibly damaging 0.95
R7284:Ikbkb UTSW 8 22668960 missense probably benign 0.32
R7383:Ikbkb UTSW 8 22669050 missense probably benign
R7768:Ikbkb UTSW 8 22695236 missense probably damaging 0.99
R7819:Ikbkb UTSW 8 22671726 missense probably benign 0.05
R8332:Ikbkb UTSW 8 22665625 missense possibly damaging 0.79
R8369:Ikbkb UTSW 8 22691081 missense probably benign 0.32
R8421:Ikbkb UTSW 8 22678788 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACATTCCAAGTAAAGGAGGC -3'
(R):5'- TGTTCAGGTCACAGGAGAAGC -3'

Sequencing Primer
(F):5'- AGGAGGCTTTATATACTCAGAACC -3'
(R):5'- CATGATGTAAGGCAGGGGC -3'
Posted On2019-10-24