Incidental Mutation 'R7633:Sltm'
ID 589762
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene Name SAFB-like, transcription modulator
Synonyms 5730455C01Rik, 5730555F13Rik, 9130215G10Rik
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 70450036-70499516 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 70493955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 802 (P802R)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
AlphaFold Q8CH25
Predicted Effect possibly damaging
Transcript: ENSMUST00000049263
AA Change: P802R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: P802R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: P784R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Fam117b A G 1: 60,020,693 (GRCm39) D521G probably damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hgs A T 11: 120,365,128 (GRCm39) Q172L probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Mrgprb1 A G 7: 48,097,331 (GRCm39) F194L probably benign Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Or8s5 A G 15: 98,237,967 (GRCm39) I301T probably damaging Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Ppfia1 T C 7: 144,106,173 (GRCm39) D33G possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Qrich2 A T 11: 116,347,455 (GRCm39) I1123K unknown Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Synpo G A 18: 60,736,500 (GRCm39) T482I probably damaging Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Tyw5 A T 1: 57,432,644 (GRCm39) D117E probably benign Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70,486,624 (GRCm39) missense probably damaging 1.00
IGL01755:Sltm APN 9 70,491,204 (GRCm39) splice site probably null
IGL01782:Sltm APN 9 70,480,923 (GRCm39) missense probably damaging 1.00
IGL02441:Sltm APN 9 70,494,467 (GRCm39) missense probably damaging 1.00
IGL02831:Sltm APN 9 70,492,147 (GRCm39) missense probably damaging 1.00
IGL02947:Sltm APN 9 70,498,946 (GRCm39) missense probably benign 0.05
IGL03166:Sltm APN 9 70,450,251 (GRCm39) missense possibly damaging 0.87
R0288:Sltm UTSW 9 70,486,633 (GRCm39) missense probably damaging 1.00
R0555:Sltm UTSW 9 70,493,363 (GRCm39) missense probably damaging 1.00
R0815:Sltm UTSW 9 70,469,190 (GRCm39) missense probably benign 0.04
R0863:Sltm UTSW 9 70,469,190 (GRCm39) missense probably benign 0.04
R1315:Sltm UTSW 9 70,450,347 (GRCm39) missense probably benign 0.13
R1533:Sltm UTSW 9 70,493,948 (GRCm39) missense probably damaging 1.00
R1676:Sltm UTSW 9 70,480,929 (GRCm39) missense probably damaging 1.00
R1764:Sltm UTSW 9 70,469,082 (GRCm39) missense probably benign 0.00
R1845:Sltm UTSW 9 70,450,314 (GRCm39) missense possibly damaging 0.60
R2049:Sltm UTSW 9 70,488,583 (GRCm39) missense probably benign 0.00
R2163:Sltm UTSW 9 70,498,964 (GRCm39) missense probably damaging 0.99
R3410:Sltm UTSW 9 70,493,240 (GRCm39) missense probably damaging 0.97
R4323:Sltm UTSW 9 70,487,529 (GRCm39) missense probably benign
R4632:Sltm UTSW 9 70,486,651 (GRCm39) missense possibly damaging 0.86
R4748:Sltm UTSW 9 70,488,647 (GRCm39) missense probably damaging 1.00
R4756:Sltm UTSW 9 70,498,892 (GRCm39) missense possibly damaging 0.57
R4782:Sltm UTSW 9 70,496,339 (GRCm39) missense probably damaging 1.00
R4799:Sltm UTSW 9 70,496,339 (GRCm39) missense probably damaging 1.00
R4887:Sltm UTSW 9 70,496,260 (GRCm39) missense probably damaging 1.00
R5221:Sltm UTSW 9 70,486,685 (GRCm39) missense probably damaging 1.00
R5263:Sltm UTSW 9 70,492,081 (GRCm39) missense unknown
R5982:Sltm UTSW 9 70,494,086 (GRCm39) missense probably damaging 1.00
R6297:Sltm UTSW 9 70,488,641 (GRCm39) missense probably damaging 0.99
R6456:Sltm UTSW 9 70,450,269 (GRCm39) missense probably damaging 1.00
R6658:Sltm UTSW 9 70,488,644 (GRCm39) missense probably damaging 1.00
R6720:Sltm UTSW 9 70,480,992 (GRCm39) missense probably damaging 1.00
R6770:Sltm UTSW 9 70,492,059 (GRCm39) missense unknown
R6923:Sltm UTSW 9 70,481,892 (GRCm39) missense probably damaging 1.00
R7051:Sltm UTSW 9 70,466,348 (GRCm39) missense probably damaging 1.00
R7166:Sltm UTSW 9 70,492,132 (GRCm39) missense probably damaging 1.00
R7257:Sltm UTSW 9 70,451,247 (GRCm39) splice site probably null
R7400:Sltm UTSW 9 70,493,352 (GRCm39) missense probably damaging 1.00
R7438:Sltm UTSW 9 70,480,748 (GRCm39) missense unknown
R7484:Sltm UTSW 9 70,481,179 (GRCm39) missense unknown
R7630:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7631:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7632:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7862:Sltm UTSW 9 70,479,446 (GRCm39) nonsense probably null
R7885:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7886:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7888:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7889:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7891:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7915:Sltm UTSW 9 70,494,431 (GRCm39) missense probably damaging 1.00
R8030:Sltm UTSW 9 70,493,261 (GRCm39) nonsense probably null
R8062:Sltm UTSW 9 70,480,779 (GRCm39) missense unknown
R8099:Sltm UTSW 9 70,493,360 (GRCm39) missense probably damaging 1.00
R8374:Sltm UTSW 9 70,469,227 (GRCm39) missense probably null
R8698:Sltm UTSW 9 70,494,352 (GRCm39) missense probably benign 0.27
R9541:Sltm UTSW 9 70,481,057 (GRCm39) missense unknown
R9563:Sltm UTSW 9 70,480,841 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAACCAGCCTTTGTATTAGACAGC -3'
(R):5'- ACCTCAGGTCGGTCATGAAG -3'

Sequencing Primer
(F):5'- AGCTCAATTTAAAAGAAGATCATTGC -3'
(R):5'- CCTCAGGTCGGTCATGAAGGATTAC -3'
Posted On 2019-10-24