Incidental Mutation 'R7633:Anks1b'
ID589766
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90948584 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1138 (D1138A)
Ref Sequence ENSEMBL: ENSMUSP00000138539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099364] [ENSMUST00000099366] [ENSMUST00000179337] [ENSMUST00000179694] [ENSMUST00000182053] [ENSMUST00000182113] [ENSMUST00000182284] [ENSMUST00000182356] [ENSMUST00000182430] [ENSMUST00000182550] [ENSMUST00000182595] [ENSMUST00000182600] [ENSMUST00000182786] [ENSMUST00000182907] [ENSMUST00000182960] [ENSMUST00000182966] [ENSMUST00000183136] [ENSMUST00000183156]
Predicted Effect probably damaging
Transcript: ENSMUST00000099364
AA Change: D365A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096965
Gene: ENSMUSG00000058589
AA Change: D365A

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
PTB 131 269 1.5e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099366
AA Change: D145A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096967
Gene: ENSMUSG00000058589
AA Change: D145A

DomainStartEndE-ValueType
PTB 63 201 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179337
AA Change: D145A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136410
Gene: ENSMUSG00000058589
AA Change: D145A

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
PTB 156 294 1.6e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179694
AA Change: D145A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136146
Gene: ENSMUSG00000058589
AA Change: D145A

DomainStartEndE-ValueType
PTB 96 234 1.5e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182053
AA Change: D274A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138644
Gene: ENSMUSG00000058589
AA Change: D274A

DomainStartEndE-ValueType
SAM 2 71 1.19e-19 SMART
SAM 76 144 5.66e-17 SMART
PTB 192 330 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182113
AA Change: D389A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138655
Gene: ENSMUSG00000058589
AA Change: D389A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182284
AA Change: D330A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138794
Gene: ENSMUSG00000058589
AA Change: D330A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 248 386 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182356
AA Change: D308A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138234
Gene: ENSMUSG00000058589
AA Change: D308A

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
low complexity region 138 153 N/A INTRINSIC
PTB 226 364 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182430
AA Change: D305A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138660
Gene: ENSMUSG00000058589
AA Change: D305A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 223 361 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182550
AA Change: D390A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138643
Gene: ENSMUSG00000058589
AA Change: D390A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 308 446 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182595
AA Change: D365A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138314
Gene: ENSMUSG00000058589
AA Change: D365A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 283 421 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182600
AA Change: D298A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138650
Gene: ENSMUSG00000058589
AA Change: D298A

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
PTB 216 354 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182786
AA Change: D237A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138720
Gene: ENSMUSG00000058589
AA Change: D237A

DomainStartEndE-ValueType
Pfam:SAM_2 1 42 8.4e-8 PFAM
Pfam:SAM_1 2 43 5.4e-7 PFAM
Pfam:SAM_1 51 97 4.4e-10 PFAM
Pfam:SAM_2 52 95 6.1e-7 PFAM
PTB 155 293 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182960
AA Change: D329A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138222
Gene: ENSMUSG00000058589
AA Change: D329A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 247 385 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182966
AA Change: D170A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138610
Gene: ENSMUSG00000058589
AA Change: D170A

DomainStartEndE-ValueType
PTB 88 226 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183024
Predicted Effect probably damaging
Transcript: ENSMUST00000183136
AA Change: D389A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138738
Gene: ENSMUSG00000058589
AA Change: D389A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183156
AA Change: D1138A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: D1138A

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R7211:Anks1b UTSW 10 90511070 missense possibly damaging 0.94
R7241:Anks1b UTSW 10 90512837 missense probably damaging 1.00
R7264:Anks1b UTSW 10 90512870 missense probably benign 0.08
R7325:Anks1b UTSW 10 90941432 missense probably damaging 1.00
R7392:Anks1b UTSW 10 90680786 missense possibly damaging 0.47
R7578:Anks1b UTSW 10 90049927 missense probably damaging 1.00
R7604:Anks1b UTSW 10 90260846 intron probably null
R7881:Anks1b UTSW 10 90967018 missense probably benign 0.07
R7910:Anks1b UTSW 10 90680792 missense probably damaging 1.00
R7964:Anks1b UTSW 10 90967018 missense probably benign 0.07
R7991:Anks1b UTSW 10 90680792 missense probably damaging 1.00
R8045:Anks1b UTSW 10 90680860 missense probably benign
RF004:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF008:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF017:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF018:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF023:Anks1b UTSW 10 90033225 missense probably damaging 1.00
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGGCAGCTCATTGAGTC -3'
(R):5'- TCATCATGGCAGACTGAGC -3'

Sequencing Primer
(F):5'- CAGCTCATTGAGTCACTTTGGACTAG -3'
(R):5'- TGGCAGACTGAGCAAAGTGATCTATC -3'
Posted On2019-10-24