Incidental Mutation 'R7633:4930504O13Rik'
ID 589769
Institutional Source Beutler Lab
Gene Symbol 4930504O13Rik
Ensembl Gene ENSMUSG00000052642
Gene Name RIKEN cDNA 4930504O13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 58446149-58452923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 58447478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 29 (M29I)
Ref Sequence ENSEMBL: ENSMUSP00000063665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064614]
AlphaFold Q8C5Z9
Predicted Effect probably benign
Transcript: ENSMUST00000064614
AA Change: M29I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000063665
Gene: ENSMUSG00000052642
AA Change: M29I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UPAR_LY6 47 124 1.3e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in 4930504O13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03073:4930504O13Rik APN 11 58447451 missense probably damaging 0.96
R1259:4930504O13Rik UTSW 11 58447470 missense probably benign 0.01
R6188:4930504O13Rik UTSW 11 58446356 missense probably benign 0.23
R6276:4930504O13Rik UTSW 11 58446366 missense possibly damaging 0.51
R7662:4930504O13Rik UTSW 11 58447443 missense probably benign
R8819:4930504O13Rik UTSW 11 58446303 missense probably damaging 0.99
R8820:4930504O13Rik UTSW 11 58446303 missense probably damaging 0.99
R9008:4930504O13Rik UTSW 11 58447383 missense probably benign
R9504:4930504O13Rik UTSW 11 58446389 missense probably benign 0.23
Z1177:4930504O13Rik UTSW 11 58446274 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACGTGCTTTTGGGTCCATTC -3'
(R):5'- TGGAGACACATGATGGACACAC -3'

Sequencing Primer
(F):5'- GGGTCCATTCTCTCAAGCAC -3'
(R):5'- CAGATTTGCTGCCTCATGACTGAG -3'
Posted On 2019-10-24