Incidental Mutation 'R7633:Plxdc1'
ID589773
Institutional Source Beutler Lab
Gene Symbol Plxdc1
Ensembl Gene ENSMUSG00000017417
Gene Nameplexin domain containing 1
Synonyms2410003I07Rik, Tem7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97923238-97986444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97956151 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 147 (F147L)
Ref Sequence ENSEMBL: ENSMUSP00000103191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017561] [ENSMUST00000107565]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017561
AA Change: F140L

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017561
Gene: ENSMUSG00000017417
AA Change: F140L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 304 349 5.98e-2 SMART
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107565
AA Change: F147L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103191
Gene: ENSMUSG00000017417
AA Change: F147L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 311 356 5.98e-2 SMART
transmembrane domain 432 454 N/A INTRINSIC
Meta Mutation Damage Score 0.6693 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Plxdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Plxdc1 APN 11 97924582 missense probably damaging 0.98
IGL02490:Plxdc1 APN 11 97954778 missense probably benign 0.17
IGL02568:Plxdc1 APN 11 97978564 missense probably damaging 1.00
IGL02618:Plxdc1 APN 11 97932304 missense probably benign
IGL03169:Plxdc1 APN 11 97932320 missense possibly damaging 0.80
R0200:Plxdc1 UTSW 11 97934012 missense probably damaging 1.00
R0627:Plxdc1 UTSW 11 97932204 splice site probably null
R1510:Plxdc1 UTSW 11 97932324 missense probably damaging 1.00
R2144:Plxdc1 UTSW 11 97934012 missense probably damaging 1.00
R5334:Plxdc1 UTSW 11 97956105 missense possibly damaging 0.87
R6084:Plxdc1 UTSW 11 97928463 missense probably damaging 1.00
R6243:Plxdc1 UTSW 11 97955473 missense probably damaging 1.00
R6305:Plxdc1 UTSW 11 97938590 missense probably damaging 1.00
R7224:Plxdc1 UTSW 11 97932327 missense possibly damaging 0.88
R7574:Plxdc1 UTSW 11 97956490 missense possibly damaging 0.89
R7909:Plxdc1 UTSW 11 97932304 missense probably benign
R8056:Plxdc1 UTSW 11 97978517 missense probably damaging 0.99
R8536:Plxdc1 UTSW 11 97978696 splice site probably null
R8754:Plxdc1 UTSW 11 97955511 missense possibly damaging 0.80
R8796:Plxdc1 UTSW 11 97956581 missense probably benign 0.02
RF007:Plxdc1 UTSW 11 97978678 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GAACTCATGCTCAGAGTCCC -3'
(R):5'- TTCAGTCAGAGGAAGCTCAGTG -3'

Sequencing Primer
(F):5'- GCAATTGAGACAGTCCCTGAGTTC -3'
(R):5'- CAGAGGAAGCTCAGTGGGGTAC -3'
Posted On2019-10-24