Incidental Mutation 'R7633:Qrich2'
ID 589774
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Name glutamine rich 2
Synonyms LOC217341
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 116332151-116357067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 116347455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 1123 (I1123K)
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
AlphaFold Q3V2A7
Predicted Effect probably benign
Transcript: ENSMUST00000093909
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208602
AA Change: I1123K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Fam117b A G 1: 60,020,693 (GRCm39) D521G probably damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hgs A T 11: 120,365,128 (GRCm39) Q172L probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Mrgprb1 A G 7: 48,097,331 (GRCm39) F194L probably benign Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Or8s5 A G 15: 98,237,967 (GRCm39) I301T probably damaging Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Ppfia1 T C 7: 144,106,173 (GRCm39) D33G possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Synpo G A 18: 60,736,500 (GRCm39) T482I probably damaging Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Tyw5 A T 1: 57,432,644 (GRCm39) D117E probably benign Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116,347,025 (GRCm39) small deletion probably benign
R0122:Qrich2 UTSW 11 116,337,639 (GRCm39) missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116,332,221 (GRCm39) missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116,332,311 (GRCm39) missense probably benign 0.08
R1786:Qrich2 UTSW 11 116,332,275 (GRCm39) missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116,337,982 (GRCm39) missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116,339,243 (GRCm39) splice site probably benign
R2178:Qrich2 UTSW 11 116,334,603 (GRCm39) missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116,336,477 (GRCm39) missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116,337,741 (GRCm39) missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116,337,599 (GRCm39) missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116,337,976 (GRCm39) missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116,339,191 (GRCm39) missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116,336,774 (GRCm39) critical splice donor site probably null
R5589:Qrich2 UTSW 11 116,332,234 (GRCm39) missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116,335,828 (GRCm39) missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116,337,832 (GRCm39) intron probably benign
R6183:Qrich2 UTSW 11 116,348,955 (GRCm39) unclassified probably benign
R6193:Qrich2 UTSW 11 116,344,979 (GRCm39) missense probably benign 0.07
R6211:Qrich2 UTSW 11 116,344,368 (GRCm39) missense probably benign 0.41
R6375:Qrich2 UTSW 11 116,349,054 (GRCm39) unclassified probably benign
R6452:Qrich2 UTSW 11 116,346,714 (GRCm39) missense probably benign 0.01
R6870:Qrich2 UTSW 11 116,346,156 (GRCm39) missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116,337,701 (GRCm39) missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116,347,080 (GRCm39) missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116,346,547 (GRCm39) missense probably benign 0.00
R7586:Qrich2 UTSW 11 116,346,450 (GRCm39) missense probably benign 0.43
R7588:Qrich2 UTSW 11 116,356,763 (GRCm39) missense possibly damaging 0.53
R7638:Qrich2 UTSW 11 116,346,148 (GRCm39) missense probably benign 0.00
R7736:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R7737:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R7753:Qrich2 UTSW 11 116,347,868 (GRCm39) small deletion probably benign
R7800:Qrich2 UTSW 11 116,347,686 (GRCm39) nonsense probably null
R7833:Qrich2 UTSW 11 116,346,591 (GRCm39) missense probably benign 0.04
R7912:Qrich2 UTSW 11 116,346,608 (GRCm39) small deletion probably benign
R7923:Qrich2 UTSW 11 116,348,163 (GRCm39) missense probably damaging 1.00
R8197:Qrich2 UTSW 11 116,347,861 (GRCm39) small deletion probably benign
R8225:Qrich2 UTSW 11 116,344,894 (GRCm39) missense probably damaging 1.00
R8300:Qrich2 UTSW 11 116,347,175 (GRCm39) missense probably benign 0.04
R8391:Qrich2 UTSW 11 116,356,403 (GRCm39) missense probably benign 0.00
R8705:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R8792:Qrich2 UTSW 11 116,347,456 (GRCm39) missense unknown
R8912:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9025:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9121:Qrich2 UTSW 11 116,347,272 (GRCm39) missense unknown
R9130:Qrich2 UTSW 11 116,347,692 (GRCm39) nonsense probably null
R9219:Qrich2 UTSW 11 116,335,900 (GRCm39) missense possibly damaging 0.47
R9254:Qrich2 UTSW 11 116,348,934 (GRCm39) missense unknown
R9256:Qrich2 UTSW 11 116,356,450 (GRCm39) missense probably benign 0.10
R9288:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9379:Qrich2 UTSW 11 116,348,934 (GRCm39) missense unknown
R9448:Qrich2 UTSW 11 116,338,091 (GRCm39) missense probably benign 0.01
R9521:Qrich2 UTSW 11 116,339,208 (GRCm39) missense probably damaging 1.00
R9620:Qrich2 UTSW 11 116,337,946 (GRCm39) missense probably damaging 1.00
R9631:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9639:Qrich2 UTSW 11 116,346,924 (GRCm39) missense probably benign 0.00
R9694:Qrich2 UTSW 11 116,337,946 (GRCm39) missense probably damaging 1.00
Z1176:Qrich2 UTSW 11 116,347,204 (GRCm39) missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116,347,494 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTCAGGTTGTGCCACACC -3'
(R):5'- GTTGCATACTCACTTGGCTTGG -3'

Sequencing Primer
(F):5'- TTGCCAGGGTGTGCCAC -3'
(R):5'- CTTGGGCCAACCTGGTATAG -3'
Posted On 2019-10-24