Incidental Mutation 'R7633:Tmc6'
ID589775
Institutional Source Beutler Lab
Gene Symbol Tmc6
Ensembl Gene ENSMUSG00000025572
Gene Nametransmembrane channel-like gene family 6
SynonymsD11Ertd204e, EVER1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location117765988-117782198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 117769220 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 694 (T694K)
Ref Sequence ENSEMBL: ENSMUSP00000026659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000131606]
Predicted Effect probably benign
Transcript: ENSMUST00000026659
AA Change: T694K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572
AA Change: T694K

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131606
SMART Domains Protein: ENSMUSP00000123264
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149589
SMART Domains Protein: ENSMUSP00000116521
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
Pfam:TMC 61 108 1.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Tmc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Tmc6 APN 11 117779046 missense probably damaging 0.99
IGL02637:Tmc6 APN 11 117767590 missense possibly damaging 0.94
PIT4520001:Tmc6 UTSW 11 117772730 missense possibly damaging 0.55
R0140:Tmc6 UTSW 11 117766251 unclassified probably benign
R0149:Tmc6 UTSW 11 117769448 missense probably damaging 1.00
R0437:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R1566:Tmc6 UTSW 11 117769436 missense probably damaging 0.99
R2011:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2012:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2169:Tmc6 UTSW 11 117769106 missense probably damaging 1.00
R2568:Tmc6 UTSW 11 117772820 missense probably benign 0.08
R3853:Tmc6 UTSW 11 117773058 nonsense probably null
R4049:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R4655:Tmc6 UTSW 11 117773042 missense possibly damaging 0.62
R4708:Tmc6 UTSW 11 117768948 missense probably benign 0.00
R5001:Tmc6 UTSW 11 117770784 missense probably benign 0.28
R5115:Tmc6 UTSW 11 117775188 missense probably damaging 0.98
R5551:Tmc6 UTSW 11 117769445 missense probably damaging 1.00
R5667:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5671:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5763:Tmc6 UTSW 11 117769433 missense possibly damaging 0.90
R6137:Tmc6 UTSW 11 117776328 missense probably damaging 1.00
R6354:Tmc6 UTSW 11 117774236 missense probably benign 0.32
R6418:Tmc6 UTSW 11 117770500 missense probably damaging 0.99
R6868:Tmc6 UTSW 11 117774317 missense probably benign 0.01
R7006:Tmc6 UTSW 11 117774257 missense probably damaging 0.96
R7208:Tmc6 UTSW 11 117776325 missense probably benign 0.41
R7210:Tmc6 UTSW 11 117775844 missense possibly damaging 0.59
Z1177:Tmc6 UTSW 11 117778747 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGATGACAGCCCTGAGGAG -3'
(R):5'- CTATGCTGTCTGGCAGTGAG -3'

Sequencing Primer
(F):5'- TGACAGGGCCAGGACAACAC -3'
(R):5'- TGTACTAGCTGAGAGTGGG -3'
Posted On2019-10-24