Incidental Mutation 'R7633:Hgs'
ID 589776
Institutional Source Beutler Lab
Gene Symbol Hgs
Ensembl Gene ENSMUSG00000116045
Gene Name HGF-regulated tyrosine kinase substrate
Synonyms Hrs, tn
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.800) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 120358461-120374805 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120365128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 172 (Q172L)
Ref Sequence ENSEMBL: ENSMUSP00000026900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026900] [ENSMUST00000106203] [ENSMUST00000106205] [ENSMUST00000140862]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026900
AA Change: Q172L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026900
Gene: ENSMUSG00000116045
AA Change: Q172L

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 406 500 1.2e-41 PFAM
low complexity region 637 658 N/A INTRINSIC
low complexity region 746 767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106203
AA Change: Q172L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101809
Gene: ENSMUSG00000025793
AA Change: Q172L

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 405 500 2.2e-48 PFAM
low complexity region 724 739 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106205
AA Change: Q172L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101811
Gene: ENSMUSG00000025793
AA Change: Q172L

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 404 499 2.2e-48 PFAM
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135231
SMART Domains Protein: ENSMUSP00000115037
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
Pfam:Hrs_helical 112 172 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140862
AA Change: Q156L

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119396
Gene: ENSMUSG00000025793
AA Change: Q156L

DomainStartEndE-ValueType
VHS 8 123 1.29e-48 SMART
FYVE 139 205 1.81e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates endosomal sorting and plays a critical role in the recycling and degradation of membrane receptors. The encoded protein sorts monoubiquitinated membrane proteins into the multivesicular body, targeting these proteins for lysosome-dependent degradation. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis with decreased size and no embryo turning. In addition, one allele shows cardia bifida, no foregut formation, failure of chorioallantoic fusion and neural tube,somite and allantois defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Fam117b A G 1: 60,020,693 (GRCm39) D521G probably damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Mrgprb1 A G 7: 48,097,331 (GRCm39) F194L probably benign Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Or8s5 A G 15: 98,237,967 (GRCm39) I301T probably damaging Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Ppfia1 T C 7: 144,106,173 (GRCm39) D33G possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Qrich2 A T 11: 116,347,455 (GRCm39) I1123K unknown Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Synpo G A 18: 60,736,500 (GRCm39) T482I probably damaging Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Tyw5 A T 1: 57,432,644 (GRCm39) D117E probably benign Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Hgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Hgs APN 11 120,366,040 (GRCm39) missense probably damaging 1.00
IGL01520:Hgs APN 11 120,369,174 (GRCm39) missense probably damaging 1.00
IGL01532:Hgs APN 11 120,368,335 (GRCm39) splice site probably null
IGL02346:Hgs APN 11 120,373,377 (GRCm39) missense probably damaging 0.99
IGL02808:Hgs APN 11 120,360,492 (GRCm39) nonsense probably null
LCD18:Hgs UTSW 11 120,360,404 (GRCm39) splice site probably benign
R0100:Hgs UTSW 11 120,373,678 (GRCm39) missense possibly damaging 0.83
R0462:Hgs UTSW 11 120,369,970 (GRCm39) missense possibly damaging 0.96
R0653:Hgs UTSW 11 120,359,904 (GRCm39) missense probably damaging 1.00
R0719:Hgs UTSW 11 120,362,431 (GRCm39) critical splice donor site probably null
R1482:Hgs UTSW 11 120,370,866 (GRCm39) missense probably benign 0.09
R1757:Hgs UTSW 11 120,370,889 (GRCm39) missense probably damaging 0.98
R1782:Hgs UTSW 11 120,369,331 (GRCm39) missense probably damaging 1.00
R2311:Hgs UTSW 11 120,370,474 (GRCm39) missense probably damaging 1.00
R4077:Hgs UTSW 11 120,368,202 (GRCm39) missense probably damaging 1.00
R4078:Hgs UTSW 11 120,373,874 (GRCm39) missense probably benign 0.04
R4079:Hgs UTSW 11 120,373,874 (GRCm39) missense probably benign 0.04
R4094:Hgs UTSW 11 120,359,859 (GRCm39) nonsense probably null
R4204:Hgs UTSW 11 120,368,013 (GRCm39) missense probably damaging 1.00
R4911:Hgs UTSW 11 120,368,028 (GRCm39) missense probably damaging 0.98
R6477:Hgs UTSW 11 120,360,481 (GRCm39) missense probably damaging 1.00
R6816:Hgs UTSW 11 120,362,397 (GRCm39) missense probably damaging 1.00
R7264:Hgs UTSW 11 120,365,139 (GRCm39) missense probably benign 0.00
R7807:Hgs UTSW 11 120,370,760 (GRCm39) missense probably damaging 1.00
R8683:Hgs UTSW 11 120,366,044 (GRCm39) nonsense probably null
R8733:Hgs UTSW 11 120,360,954 (GRCm39) critical splice donor site probably null
R8798:Hgs UTSW 11 120,370,938 (GRCm39) missense probably benign 0.08
R8866:Hgs UTSW 11 120,360,464 (GRCm39) missense probably benign 0.10
R8910:Hgs UTSW 11 120,369,202 (GRCm39) critical splice donor site probably null
R9081:Hgs UTSW 11 120,366,076 (GRCm39) splice site probably benign
X0024:Hgs UTSW 11 120,368,140 (GRCm39) missense probably damaging 1.00
Z1177:Hgs UTSW 11 120,369,391 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTTAACCCTGGGCCATG -3'
(R):5'- ATGATGACACTGAGCACCACAG -3'

Sequencing Primer
(F):5'- AACCCTGGGCCATGTGGTTTAG -3'
(R):5'- GGCAAACACCAAGCTCCGG -3'
Posted On 2019-10-24