Incidental Mutation 'R7633:Hgs'
ID589776
Institutional Source Beutler Lab
Gene Symbol Hgs
Ensembl Gene ENSMUSG00000116045
Gene Name
SynonymsHrs
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120467635-120483984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120474302 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 172 (Q172L)
Ref Sequence ENSEMBL: ENSMUSP00000026900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026900] [ENSMUST00000106203] [ENSMUST00000106205] [ENSMUST00000140862]
Predicted Effect probably damaging
Transcript: ENSMUST00000026900
AA Change: Q172L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026900
Gene: ENSMUSG00000116045
AA Change: Q172L

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 406 500 1.2e-41 PFAM
low complexity region 637 658 N/A INTRINSIC
low complexity region 746 767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106203
AA Change: Q172L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101809
Gene: ENSMUSG00000025793
AA Change: Q172L

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 405 500 2.2e-48 PFAM
low complexity region 724 739 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106205
AA Change: Q172L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101811
Gene: ENSMUSG00000025793
AA Change: Q172L

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 404 499 2.2e-48 PFAM
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135231
SMART Domains Protein: ENSMUSP00000115037
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
Pfam:Hrs_helical 112 172 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140862
AA Change: Q156L

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119396
Gene: ENSMUSG00000025793
AA Change: Q156L

DomainStartEndE-ValueType
VHS 8 123 1.29e-48 SMART
FYVE 139 205 1.81e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates endosomal sorting and plays a critical role in the recycling and degradation of membrane receptors. The encoded protein sorts monoubiquitinated membrane proteins into the multivesicular body, targeting these proteins for lysosome-dependent degradation. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis with decreased size and no embryo turning. In addition, one allele shows cardia bifida, no foregut formation, failure of chorioallantoic fusion and neural tube,somite and allantois defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Hgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Hgs APN 11 120475214 missense probably damaging 1.00
IGL01520:Hgs APN 11 120478348 missense probably damaging 1.00
IGL01532:Hgs APN 11 120477509 unclassified probably null
IGL02346:Hgs APN 11 120482551 missense probably damaging 0.99
IGL02808:Hgs APN 11 120469666 nonsense probably null
LCD18:Hgs UTSW 11 120469578 splice site probably benign
R0100:Hgs UTSW 11 120482852 missense possibly damaging 0.83
R0462:Hgs UTSW 11 120479144 missense possibly damaging 0.96
R0653:Hgs UTSW 11 120469078 missense probably damaging 1.00
R0719:Hgs UTSW 11 120471605 critical splice donor site probably null
R1482:Hgs UTSW 11 120480040 missense probably benign 0.09
R1757:Hgs UTSW 11 120480063 missense probably damaging 0.98
R1782:Hgs UTSW 11 120478505 missense probably damaging 1.00
R2311:Hgs UTSW 11 120479648 missense probably damaging 1.00
R4077:Hgs UTSW 11 120477376 missense probably damaging 1.00
R4078:Hgs UTSW 11 120483048 missense probably benign 0.04
R4079:Hgs UTSW 11 120483048 missense probably benign 0.04
R4094:Hgs UTSW 11 120469033 nonsense probably null
R4204:Hgs UTSW 11 120477187 missense probably damaging 1.00
R4911:Hgs UTSW 11 120477202 missense probably damaging 0.98
R6477:Hgs UTSW 11 120469655 missense probably damaging 1.00
R6816:Hgs UTSW 11 120471571 missense probably damaging 1.00
R7264:Hgs UTSW 11 120474313 missense probably benign 0.00
R7807:Hgs UTSW 11 120479934 missense probably damaging 1.00
X0024:Hgs UTSW 11 120477314 missense probably damaging 1.00
Z1177:Hgs UTSW 11 120478565 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTTAACCCTGGGCCATG -3'
(R):5'- ATGATGACACTGAGCACCACAG -3'

Sequencing Primer
(F):5'- AACCCTGGGCCATGTGGTTTAG -3'
(R):5'- GGCAAACACCAAGCTCCGG -3'
Posted On2019-10-24