Incidental Mutation 'R7633:Dcxr'
ID589777
Institutional Source Beutler Lab
Gene Symbol Dcxr
Ensembl Gene ENSMUSG00000039450
Gene Namedicarbonyl L-xylulose reductase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120725399-120727281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120726453 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 88 (L88R)
Ref Sequence ENSEMBL: ENSMUSP00000026144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018156] [ENSMUST00000026144] [ENSMUST00000026148] [ENSMUST00000106148] [ENSMUST00000142229]
Predicted Effect probably benign
Transcript: ENSMUST00000018156
SMART Domains Protein: ENSMUSP00000018156
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 179 8.8e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026144
AA Change: L88R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000026144
Gene: ENSMUSG00000039450
AA Change: L88R

DomainStartEndE-ValueType
Pfam:adh_short 8 195 8.9e-51 PFAM
Pfam:KR 9 175 7.1e-9 PFAM
Pfam:Epimerase 10 227 2.3e-7 PFAM
Pfam:adh_short_C2 14 242 6.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026148
SMART Domains Protein: ENSMUSP00000026148
Gene: ENSMUSG00000025150

DomainStartEndE-ValueType
Pfam:KR 9 178 8.5e-8 PFAM
Pfam:adh_short 9 195 4.6e-55 PFAM
Pfam:adh_short_C2 14 242 9.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106148
AA Change: L88R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101754
Gene: ENSMUSG00000039450
AA Change: L88R

DomainStartEndE-ValueType
Pfam:adh_short 8 151 2.1e-22 PFAM
Pfam:KR 9 151 4.7e-7 PFAM
Pfam:NAD_binding_10 11 182 3.9e-9 PFAM
Pfam:adh_short_C2 14 150 2.2e-8 PFAM
Pfam:adh_short_C2 157 234 4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142229
SMART Domains Protein: ENSMUSP00000119523
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 172 3.19e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154565
SMART Domains Protein: ENSMUSP00000117739
Gene: ENSMUSG00000025150

DomainStartEndE-ValueType
Pfam:adh_short 1 45 6.2e-10 PFAM
Pfam:adh_short_C2 33 154 9.7e-18 PFAM
Pfam:adh_short 41 123 2.2e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to catalyze diacetyl reductase and L-xylulose reductase reactions. The encoded protein may play a role in the uronate cycle of glucose metabolism and in the cellular osmoregulation in the proximal renal tubules. Defects in this gene are a cause of pentosuria. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Dcxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Dcxr APN 11 120726167 missense possibly damaging 0.75
IGL01516:Dcxr APN 11 120725758 unclassified probably null
IGL02151:Dcxr APN 11 120725983 missense probably benign 0.00
IGL03264:Dcxr APN 11 120726472 missense probably damaging 1.00
R0890:Dcxr UTSW 11 120726471 missense probably damaging 1.00
R1325:Dcxr UTSW 11 120726555 unclassified probably null
R1808:Dcxr UTSW 11 120725612 splice site probably null
R2099:Dcxr UTSW 11 120725577 missense probably damaging 1.00
R2102:Dcxr UTSW 11 120726307 missense probably benign 0.08
R4602:Dcxr UTSW 11 120726304 missense possibly damaging 0.49
R4772:Dcxr UTSW 11 120726097 missense probably benign 0.00
R5028:Dcxr UTSW 11 120726447 missense probably damaging 0.97
R5219:Dcxr UTSW 11 120725488 unclassified probably benign
R5336:Dcxr UTSW 11 120727176 critical splice donor site probably null
R5518:Dcxr UTSW 11 120726199 unclassified probably benign
R6613:Dcxr UTSW 11 120727006 missense probably benign 0.00
R6833:Dcxr UTSW 11 120726091 missense probably damaging 1.00
R7042:Dcxr UTSW 11 120727015 missense possibly damaging 0.66
R7531:Dcxr UTSW 11 120727006 missense probably benign 0.00
R7710:Dcxr UTSW 11 120727082 missense probably benign 0.08
Z1176:Dcxr UTSW 11 120727208 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGATGACAGCCCGAAGATTCAC -3'
(R):5'- AGGTCCAGTTTTCCCAGACTG -3'

Sequencing Primer
(F):5'- GCCCGAAGATTCACATTGAAGGATC -3'
(R):5'- TTCTGCTGGAAGAGGCAAAC -3'
Posted On2019-10-24