Incidental Mutation 'R7633:Clmn'
ID589778
Institutional Source Beutler Lab
Gene Symbol Clmn
Ensembl Gene ENSMUSG00000021097
Gene Namecalmin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104763117-104865076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104782112 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 392 (T392M)
Ref Sequence ENSEMBL: ENSMUSP00000105563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109936] [ENSMUST00000109937] [ENSMUST00000222323] [ENSMUST00000223103] [ENSMUST00000223177] [ENSMUST00000223342]
Predicted Effect probably benign
Transcript: ENSMUST00000109936
AA Change: T392M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105562
Gene: ENSMUSG00000021097
AA Change: T392M

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 996 1013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109937
AA Change: T392M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105563
Gene: ENSMUSG00000021097
AA Change: T392M

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 1027 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222323
Predicted Effect probably benign
Transcript: ENSMUST00000223103
AA Change: T392M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223177
AA Change: T392M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223342
AA Change: T392M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Clmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Clmn APN 12 104774551 critical splice acceptor site probably null
IGL01509:Clmn APN 12 104780903 missense probably benign 0.00
IGL01530:Clmn APN 12 104791856 missense probably damaging 1.00
IGL01768:Clmn APN 12 104781719 missense probably damaging 0.99
IGL01779:Clmn APN 12 104782140 missense probably benign 0.04
IGL02139:Clmn APN 12 104781099 missense probably benign 0.01
IGL02157:Clmn APN 12 104781918 missense probably benign 0.00
IGL02519:Clmn APN 12 104791853 missense probably damaging 1.00
IGL02820:Clmn APN 12 104773234 missense probably damaging 0.99
IGL03036:Clmn APN 12 104774523 missense probably damaging 0.97
R0255:Clmn UTSW 12 104781764 missense probably benign
R0478:Clmn UTSW 12 104785491 missense probably damaging 0.99
R0739:Clmn UTSW 12 104781017 missense possibly damaging 0.55
R0761:Clmn UTSW 12 104781558 missense probably damaging 0.99
R0834:Clmn UTSW 12 104771826 missense probably damaging 1.00
R0834:Clmn UTSW 12 104771827 missense probably damaging 1.00
R0864:Clmn UTSW 12 104790015 missense possibly damaging 0.94
R1569:Clmn UTSW 12 104781081 missense probably damaging 1.00
R1638:Clmn UTSW 12 104782022 missense probably benign 0.13
R1940:Clmn UTSW 12 104790102 missense probably damaging 1.00
R1974:Clmn UTSW 12 104791862 missense probably damaging 1.00
R2113:Clmn UTSW 12 104780808 missense probably benign
R4815:Clmn UTSW 12 104785566 missense probably damaging 1.00
R4863:Clmn UTSW 12 104797094 missense probably damaging 1.00
R4883:Clmn UTSW 12 104782048 missense probably benign 0.04
R5577:Clmn UTSW 12 104777070 missense probably damaging 1.00
R5853:Clmn UTSW 12 104783902 splice site probably null
R5867:Clmn UTSW 12 104781755 missense probably damaging 0.98
R6041:Clmn UTSW 12 104781872 missense probably benign 0.00
R6093:Clmn UTSW 12 104771956 missense probably benign 0.00
R6233:Clmn UTSW 12 104785455 missense probably damaging 1.00
R6239:Clmn UTSW 12 104780845 missense probably benign 0.00
R6628:Clmn UTSW 12 104773786 missense probably damaging 1.00
R6771:Clmn UTSW 12 104773782 missense probably benign 0.04
R7448:Clmn UTSW 12 104785428 missense possibly damaging 0.90
X0028:Clmn UTSW 12 104785402 missense probably benign 0.11
Z1177:Clmn UTSW 12 104781376 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ACAGCTCCTTGGTTGCCTTG -3'
(R):5'- TTGTCCGCATCAAAGAAAGC -3'

Sequencing Primer
(F):5'- TCCCCTCGAAGCGGAAGTC -3'
(R):5'- AGAAAGCCCCTCTGAGCAGG -3'
Posted On2019-10-24