Incidental Mutation 'R7633:Or8s5'
ID 589784
Institutional Source Beutler Lab
Gene Symbol Or8s5
Ensembl Gene ENSMUSG00000051793
Gene Name olfactory receptor family 8 subfamily S member 5
Synonyms Olfr284, MOR160-4, GA_x6K02T2NBG7-5395976-5396893
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 98237903-98238820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98237967 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 301 (I301T)
Ref Sequence ENSEMBL: ENSMUSP00000145864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063289] [ENSMUST00000206647]
AlphaFold A0A0U1RP76
Predicted Effect probably damaging
Transcript: ENSMUST00000063289
AA Change: I285T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065626
Gene: ENSMUSG00000051793
AA Change: I285T

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 5.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 259 1.3e-5 PFAM
Pfam:7tm_1 39 286 5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206647
AA Change: I301T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Fam117b A G 1: 60,020,693 (GRCm39) D521G probably damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hgs A T 11: 120,365,128 (GRCm39) Q172L probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Mrgprb1 A G 7: 48,097,331 (GRCm39) F194L probably benign Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Ppfia1 T C 7: 144,106,173 (GRCm39) D33G possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Qrich2 A T 11: 116,347,455 (GRCm39) I1123K unknown Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Synpo G A 18: 60,736,500 (GRCm39) T482I probably damaging Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Tyw5 A T 1: 57,432,644 (GRCm39) D117E probably benign Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Or8s5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Or8s5 APN 15 98,238,054 (GRCm39) missense possibly damaging 0.47
IGL02904:Or8s5 APN 15 98,238,729 (GRCm39) missense probably null 0.88
PIT4378001:Or8s5 UTSW 15 98,238,153 (GRCm39) missense possibly damaging 0.95
R0485:Or8s5 UTSW 15 98,238,810 (GRCm39) missense probably benign 0.01
R1435:Or8s5 UTSW 15 98,238,209 (GRCm39) missense possibly damaging 0.69
R4706:Or8s5 UTSW 15 98,238,659 (GRCm39) missense possibly damaging 0.62
R4707:Or8s5 UTSW 15 98,238,659 (GRCm39) missense possibly damaging 0.62
R5272:Or8s5 UTSW 15 98,238,246 (GRCm39) missense probably benign 0.00
R5314:Or8s5 UTSW 15 98,238,246 (GRCm39) missense probably benign 0.00
R5315:Or8s5 UTSW 15 98,238,246 (GRCm39) missense probably benign 0.00
R5316:Or8s5 UTSW 15 98,238,246 (GRCm39) missense probably benign 0.00
R5317:Or8s5 UTSW 15 98,238,246 (GRCm39) missense probably benign 0.00
R5456:Or8s5 UTSW 15 98,238,246 (GRCm39) missense probably benign 0.00
R5458:Or8s5 UTSW 15 98,238,246 (GRCm39) missense probably benign 0.00
R5548:Or8s5 UTSW 15 98,238,253 (GRCm39) missense probably benign 0.21
R5717:Or8s5 UTSW 15 98,238,246 (GRCm39) missense probably benign 0.00
R5921:Or8s5 UTSW 15 98,238,310 (GRCm39) missense probably benign 0.10
R6519:Or8s5 UTSW 15 98,237,929 (GRCm39) missense probably benign 0.00
R6636:Or8s5 UTSW 15 98,238,831 (GRCm39) missense probably benign 0.23
R7112:Or8s5 UTSW 15 98,238,421 (GRCm39) missense possibly damaging 0.81
R7289:Or8s5 UTSW 15 98,237,943 (GRCm39) missense probably damaging 1.00
R7392:Or8s5 UTSW 15 98,238,192 (GRCm39) missense probably benign 0.03
R7403:Or8s5 UTSW 15 98,238,000 (GRCm39) missense probably damaging 1.00
R7724:Or8s5 UTSW 15 98,238,775 (GRCm39) missense possibly damaging 0.89
R9451:Or8s5 UTSW 15 98,238,144 (GRCm39) missense possibly damaging 0.61
R9707:Or8s5 UTSW 15 98,238,154 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGGCATGTAACATCTTCCATCATG -3'
(R):5'- CTTATGGCCGCATTGTCACC -3'

Sequencing Primer
(F):5'- TCTTCCATCATGAATGAACAACC -3'
(R):5'- ATTGTCACCACTGTCCTGAGGG -3'
Posted On 2019-10-24